Check patentability & draft patents in minutes with Patsnap Eureka AI!

Digital isothermal nucleic acid detecting device and detecting method thereof

A detection device and nucleic acid technology, which is applied in the field of biomedical nucleic acid detection devices, can solve the problems of long detection time, high requirements for instruments, and inability to meet the needs of rapid detection of nucleic acids on site, and achieve low equipment requirements, simple chip structure, and portability and the effect of miniaturization

Inactive Publication Date: 2016-04-20
SUZHOU INST OF BIOMEDICAL ENG & TECH CHINESE ACADEMY OF SCI
View PDF5 Cites 42 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing digital PCR technology mostly uses flow detection technology, which has high requirements for instruments and a long detection time, which cannot meet the needs of rapid on-site detection of nucleic acids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Digital isothermal nucleic acid detecting device and detecting method thereof
  • Digital isothermal nucleic acid detecting device and detecting method thereof
  • Digital isothermal nucleic acid detecting device and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] see figure 1 , a digital isothermal nucleic acid detection device, which is composed of a microfluidic chip, a pressure drive system, a temperature control system, and a pipeline. The temperature control system includes a temperature control heating element and a temperature sensing chip, wherein the temperature control heating element adopts a heating plate form, attached to the upper and lower sides of the microfluidic chip.

[0042] The pressure-driven system can adopt a vacuum negative pressure system and a positive pressure system driven by a syringe pump. The vacuum negative pressure system is connected to the reaction chamber through pipelines and the connection between the two is controlled by a solenoid valve. A buffer bottle is set between the vacuum negative pressure system and the reaction chamber, and a rubber ring is used to seal the end of the pipeline and the reaction chamber. The positive pressure system of the injection pump is connected to the sample...

Embodiment 2

[0057] digital isothermal nucleic acid amplification reaction

[0058] In this embodiment, the nucleic acid detection device in Embodiment 1 is used to carry out the subsequent digital isothermal nucleic acid amplification reaction.

[0059] The structure, design and processing of the microfluidic chip are the same as in Example 1. Mycobacterium tuberculosis is used as the reaction template to investigate the performance of the device, and the template DNA is diluted to an appropriate concentration and mixed with an appropriate amount of LAMP reaction reagent:

[0060] (1) Mycobacterium tuberculosis DNA was dissolved and diluted to 5pg / ul;

[0061] (2) Prepare the LAMP reaction mixture according to the 20ul system:

[0062]

[0063] LAMP primers are as follows:

[0064] FIP: CGTGGTCCTGCGGGCTTTG-GCCAGATGCACCGTCG

[0065] BIP:ATCGCTGATCCGGCCACAG-CCCACAGCCGGTTAGGT

[0066] F3: CGTGAGGGCATCGAGGT

[0067] B3: ACACATAGGTGAGGTCTGCT

[0068] Add 20 μl of sample to the sample ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
volumeaaaaaaaaaa
widthaaaaaaaaaa
depthaaaaaaaaaa
Login to View More

Abstract

The invention provides a digital isothermal nucleic acid detecting device which comprises a micro-fluidic chip, a temperature control system and a pressure driving system. A microfluidic channel for microsphere forming and a reaction section for nucleic acid amplification are formed by the micro-fluidic chip through sequential laminating of a substrate layer, a channel layer arranged on the substrate layer and a cover plate layer arranged on the channel layer. The temperature control system comprises a lower press plate for applying pressure to the substrate from bottom to top and an upper press plate for applying pressure to the cover plate layer from top to bottom, and temperature sensing chips and temperature control heating elements for heating the reaction section are arranged in the upper press plate and the lower press plate. The pressure driving system is connected to the micro-fluidic chip and used for applying pressure to the channel layer in the micro-fluidic chip so that liquid to be detected can flow into the reaction section from the inflow end. According to the scheme, microsphere preparation and nucleic acid amplification and detection are integrated through the digital isothermal nucleic acid detecting device and the detection method, and the advantages of being high in sensitivity and the like are achieved.

Description

technical field [0001] The invention relates to a biomedical nucleic acid detection device, in particular to a microfluidic device for nucleic acid digital isothermal amplification and a detection method thereof. Background technique [0002] Current biomedical research is going deep into the molecular level from the whole and cellular level. Nucleic acid is an important class of biomolecules in cells, which participates in the regulation of most functions of cells, such as gene expression and silencing, organelle composition, and cell behavior regulation. Understanding the content and distribution of nucleic acids in different cells is crucial to the in-depth study of their functions and the biological significance behind them, and is of great significance to the diagnosis and treatment of malignant tumors, AIDS, and genetic diseases. [0003] Existing nucleic acid detection mainly adopts polymerase chain reaction (PCR), which has high sensitivity and good specificity, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12M1/38C12M1/34C12Q1/68
CPCC12Q1/6851
Inventor 张涛黎海文周武平刘聪蒋克明
Owner SUZHOU INST OF BIOMEDICAL ENG & TECH CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More