Digital isothermal nucleic acid detecting device and detecting method thereof
A detection device and nucleic acid technology, which is applied in the field of biomedical nucleic acid detection devices, can solve the problems of long detection time, high requirements for instruments, and inability to meet the needs of rapid detection of nucleic acids on site, and achieve low equipment requirements, simple chip structure, and portability and the effect of miniaturization
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] see figure 1 , a digital isothermal nucleic acid detection device, which is composed of a microfluidic chip, a pressure drive system, a temperature control system, and a pipeline. The temperature control system includes a temperature control heating element and a temperature sensing chip, wherein the temperature control heating element adopts a heating plate form, attached to the upper and lower sides of the microfluidic chip.
[0042] The pressure-driven system can adopt a vacuum negative pressure system and a positive pressure system driven by a syringe pump. The vacuum negative pressure system is connected to the reaction chamber through pipelines and the connection between the two is controlled by a solenoid valve. A buffer bottle is set between the vacuum negative pressure system and the reaction chamber, and a rubber ring is used to seal the end of the pipeline and the reaction chamber. The positive pressure system of the injection pump is connected to the sample...
Embodiment 2
[0057] digital isothermal nucleic acid amplification reaction
[0058] In this embodiment, the nucleic acid detection device in Embodiment 1 is used to carry out the subsequent digital isothermal nucleic acid amplification reaction.
[0059] The structure, design and processing of the microfluidic chip are the same as in Example 1. Mycobacterium tuberculosis is used as the reaction template to investigate the performance of the device, and the template DNA is diluted to an appropriate concentration and mixed with an appropriate amount of LAMP reaction reagent:
[0060] (1) Mycobacterium tuberculosis DNA was dissolved and diluted to 5pg / ul;
[0061] (2) Prepare the LAMP reaction mixture according to the 20ul system:
[0062]
[0063] LAMP primers are as follows:
[0064] FIP: CGTGGTCCTGCGGGCTTTG-GCCAGATGCACCGTCG
[0065] BIP:ATCGCTGATCCGGCCACAG-CCCACAGCCGGTTAGGT
[0066] F3: CGTGAGGGCATCGAGGT
[0067] B3: ACACATAGGTGAGGTCTGCT
[0068] Add 20 μl of sample to the sample ...
PUM
Property | Measurement | Unit |
---|---|---|
volume | aaaaa | aaaaa |
width | aaaaa | aaaaa |
depth | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com