Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method

A technology of Clostridium difficile toxin and Clostridium difficile, applied in the field of biomedicine, can solve the problems of difficult primer design, reduced quantity, cumbersome later verification, etc., and achieve reliable primer detection results and reliable results

Inactive Publication Date: 2016-04-27
GUANGZHOU SAGENE BIOTECH
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method can detect multiple target genes at one time, there are also many disadvantages, such as 1) The design of primers is difficult: the design of complex multiplex qPCR primers must rely on relatively large databases and computer simulation qPCR results, as well as cumbersome post-validation , this process cannot be completed by ordinary small laboratories; 2) mutual inhibition of products: the generation of multiple qPCR by-product pyrophosphate will inhibit the extension of qPCR reaction; 3) in a qPCR reaction system, the amount of dNTP raw materials is certain , so each additional primer will reduce the amount of dNTP raw material equally distributed to each target

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method
  • Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method
  • Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] 16SrDNA specific primers

[0056] The specific primer design method for Clostridium difficile 16S rDNA is as follows:

[0057] When the 16SrDNA sequences of different bacterial species are almost identical, the ability of 16SrDNA universal primers to identify bacterial species is limited. In order to solve this problem, we designed multiple primers, and after screening dozens of primers, we finally screened out 16SrDNA primers specific only to C.difficile, and identified C.difficile accordingly.

[0058] The most specific 16S rDNA primer sequences screened for detection of C.difficile are as follows:

[0059] C.diff-16s-F: TTGAGCGATTTACTTCGGTAAAGA

[0060] C.diff-16s-R:CCATCCTGTACTGGCTCACCT

[0061] 16SrDNA-specific primers for detection of C.difficile

[0062] Bacterial total genomic DNA was extracted from the feces of 234 clinical patients with intestinal diarrhea, and the most specific 16S rDNA primers screened for the detection of C.difficile were used to de...

Embodiment 2

[0069] Design method of specific primers for tcdA and tcdB gene quality control products, qPCR detection primers and probe sequences

[0070] through the NCBI database and http: / / blast.ncbi.nlm.nih.gov / Blast.cgi Online comparison software to find out the conserved sequences of tcdA gene and tcdB gene among different strains. The sequence of tcdB gene among different strains was very different, and the partial sequence similarity rate was only 94.9%. figure 1 Shown is the full-length sequence conservation analysis of the tcdB gene of different strains, and the boxed position is the position of the outer and inner primer sequence prepared by the primer tcdB quality control product. figure 2 The framed position is the qPCR primer and probe position of tcdB, so the conserved sequence of the tcdB gene was selected with the help of the Saqman software in the DNAStar software package. Finally, the primers were designed with the software PrimerPremier5.0, and the following speci...

Embodiment 3

[0125] Sensitivity comparison between this kit and the existing Clostridium difficile toxin A / B detection kit

[0126] In order to determine the sensitivity of the specific operation method of qPCR described in Example 2, we used the initial concentration of the quality control product as 2.19×10 8 copies / μL(tcdA) and 2.29×10 8 The template concentration of copies / μL (tcdB) was used to prepare the initial concentration of the standard curve, and was serially diluted with EASYDilution Absolute Quantitative Diluent in a 10-fold concentration gradient to detect the minimum detection limit of the qPCR system. In addition, primers from other literatures for detecting C.difficile toxin genes tcdA and tcdB were selected, and the system established by this method was used for qPCR to compare the sensitivity of this primer and the primers in other literatures (TcdCDoesNotSignificantlyRepressToxinExpressioninClostridiumdifficile630DErm).

[0127] Judgment criteria for results: Entero...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitative PCR detection kit for clostridium difficile toxin A / B by adopting a probe method, and a detection method, which can detect clostridium difficile and also can detect and quantify toxin A and B genes. The detection kit mainly comprises specific primers and probes, wherein the specific primers and the probes are composed of primer pairs for detecting clostridium difficile, primer pairs and probes for detecting clostridium difficile toxin A, as well as primer pairs and probes for detecting clostridium difficile toxin B. According to the detection kit and the detection method, the operation is simple, the report time is short, the clostridium difficile strains can be specifically, sensitively and accurately identified for the first time, and the key toxins A and B of clostridium difficile are detected and quantified. A foundation is laid for the early diagnosis for clostridium difficile infection, and the detection kit and the detection method are suitable for screening causes of diarrhea patients with unknown causes clinically.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a probe method fluorescent quantitative PCR detection kit and a detection method of Clostridium difficile toxin A / B. Background technique [0002] Clostridium difficile (C.difficile) is a Gram-positive, toxin-producing or non-toxin-producing anaerobic bacillus, which is widely distributed in the natural environment, animal and human feces. Clostridium difficile can parasitize in the human intestine. It is not invasive itself, but studies have found that long-term use of broad-spectrum antibiotics, especially clindamycin, cephalosporins, and quinolones, can cause flora imbalance difficile-associated diarrhea, which has been recognized as causing antibiotic-associated diarrhea (antibioticassociateddiarrhea, AAD) and pseudomembranous The important pathogenic bacteria of Pseudo-membranecolitis (PMC). The clinical manifestations of patients with Clostridium difficile infection...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/6851C12Q1/689C12Q2600/166C12Q2545/113C12Q2563/107C12Q2561/101
Inventor罗宝花曾宏彬陈杰
OwnerGUANGZHOU SAGENE BIOTECH