Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for purifying pseudomonas aeruginosa vaccine recombinant protein Vac 14

A technology of Pseudomonas aeruginosa and purification method, which is applied in the field of purification of Pseudomonas aeruginosa recombinant protein Vac14 vaccine, and can solve problems such as recombinant proteins that have not yet been seen

Active Publication Date: 2016-06-01
ARMY MEDICAL UNIV
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the purification method of the recombinant protein Vac14

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for purifying pseudomonas aeruginosa vaccine recombinant protein Vac 14
  • Method for purifying pseudomonas aeruginosa vaccine recombinant protein Vac 14
  • Method for purifying pseudomonas aeruginosa vaccine recombinant protein Vac 14

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1: Cloning of Vac14 gene and construction of recombinant plasmid pGEX-6P-2-Vac14

[0066] 1. Firstly, according to the full-length gene sequence of Vac14 protein of Pseudomonas aeruginosa PA01, the bioinformatics software was used for structural analysis to determine the target gene fragment of Vac14 to be amplified.

[0067] 2. According to the analysis results, use the PCR method to amplify the Vac14 target gene fragment from the PA01 genome. The amplification steps are as follows:

[0068] 1) Design the PCR primers as follows, which are SEQ ID NO: 3-4 (the base sequence of the restriction site is underlined)

[0069] Seq ID

Primer name

Sequence (5'-3')

Endonuclease

Seq ID 3

Vac14-F

ATCGGATCCGATCGCCTGAAGGCACTG

Bam H I

Seq ID 4

Vac14-R

CCGGAATTCTCAGCGCTTCAGCGGC

EcoR I

[0070] 2) Take out the preserved Pseudomonas aeruginosa strain PA01 from the -80°C freezer and spread it on the LB solid medi...

Embodiment 2

[0102] Example 2: Identification of recombinant fusion protein Vac14 induced expression and expression form in prokaryotic expression system-Escherichia coli

[0103] 1. Vac14 induced expression

[0104] Take 100 μL of the overnight cultured pGEX-6P-2-Vac14 / XL-1blue bacterial solution and add it to 10 mL of Amp+ resistant LB medium, culture overnight at 180 rpm at 37°C, respectively take 400 μL of the overnight cultured bacterial solution and add it to 20 mL of Amp+ resistant LB medium (The rest of the bacterial solution is stored in a refrigerator at 4°C for later use), culture at 37°C for 2-3 hours, rotate at 200 rpm, and reactivate until the OD600 is 0.8-1.0, add 4 μL of IPTG to make the final concentration 200 μM, and place on a shaker Induced expression Induced expression at 30°C for 3h.

[0105]Wherein, the preparation of IPTG solution: take 2.38g IPTG and dissolve in 10ml I grade water to dissolve completely, filter with 0.22μm sterile filter.

[0106] 2) Take out the...

Embodiment 3

[0114] Embodiment 3: Preparation of Vac14 antigen

[0115] 1. Amplify culture to obtain protein

[0116] Take 400 μL of the spare pGEX-6P-2-Vac14 / XL-1blue bacterial solution stored in the refrigerator at 4°C and add it to 20mL LB medium containing Amp resistance for one activation. After incubating at 200rpm for 5-6 hours at 37°C, take 8mL once The activated bacterial solution was added to 400mL LB medium containing Amp resistance for secondary activation, cultured at 37°C for 3-4h until the OD600 was 1.0, then added 80μLPTG (final concentration 200μM) and placed in a shaker at 16°C overnight to induce Finally, 12000rpm was centrifuged for 15min to collect the thalli, and after adding 20mLlysisbuffer (same as Example 2) to resuspend the thallus, the bacterium liquid was subjected to ultrasonic cracking for 3min (200V), and the supernatant was collected and 800 μL of GlutathioneSepharose4B (GE Company) gel beads (beads) binding treatment; then SDS-PAGE gel electrophoresis. 2....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for purifying pseudomonas aeruginosa (PA) recombinant subunit genetic engineering protein vaccine Vac 14. The Vac 14 protein is obtained in the mode that active functional fragments of pseudomonas aeruginosa antigen molecules are recombined and confused, and escherichia coli genetically engineered bacterium expression is conducted. Technologies including high pressure bacterium breaking, GST affinity chromatography, PP enzyme restriction enzyme digestion, SPHP chromatography, G25 chromatography, Q HP chromatography and the like are adopted for genetic engineering bacteria, and the high-purity pseudomonas aeruginosa (PA) recombinant subunit genetic engineering protein vaccine Vac 14 is obtained. The method is simple and fast in purifying process, easy to amplify and good in repeatability, the obtained target protein is high in purity, and it is proved by animal tests that a mechanism can be effectively stimulated to generate high humoral immune response and a good immune protective effect.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, in particular to a purification method of Pseudomonas aeruginosa (PA) recombinant protein Vac14 (β-lactamase) vaccine. Background technique [0002] Pseudomonas aeruginosa (PA), commonly known as Pseudomonas aeruginosa, is widely distributed in nature, normal human skin, intestinal tract, and respiratory tract. Infection can occur in any part and tissue of the human body. The cornea, urethra, and respiratory tract can also cause endocarditis, gastroenteritis, empyema, and even sepsis. This bacteria has become one of the pathogenic bacteria with the highest infection rate in ICU wards, burns, and war wounds in the world. More than 20%. [0003] PA pathogenic factors include biofilm, endotoxin, secreted virulence factors and proteases, quorum sensing system, etc. After natural infection, the body can induce local mucosal immunity and systemic humoral and cellular immune responses, but these respo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/21C07K1/22C07K1/16
CPCC07K14/21
Inventor 敬海明顾江邹全明章金勇孙红武付强牟道华张玉东徐丽敏
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com