Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant swine-origin antibacterial peptide as well as preparation method and application thereof

An antimicrobial peptide and porcine-derived technology, applied in the field of recombinant porcine-derived antimicrobial peptides and its preparation, can solve public health crises, threaten animal husbandry and other problems, and achieve the effects of promoting angiogenesis, reducing inflammatory reactions, and promoting wound healing

Inactive Publication Date: 2016-06-01
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] With the continuous application of antibiotics in feed production and animal breeding, many problems follow one after another, such as the long-term use of antibiotic additives leads to the emergence of drug-resistant pathogens, the emergence of drug-resistant strains not only threatens animal husbandry, but also becomes an unavoidable problem for human beings. public health crisis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant swine-origin antibacterial peptide as well as preparation method and application thereof
  • Recombinant swine-origin antibacterial peptide as well as preparation method and application thereof
  • Recombinant swine-origin antibacterial peptide as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Design and synthesis of embodiment 1 target gene

[0019] According to the secretion characteristics of Bacillus subtilis and the characteristics of downstream purification technology, the signal peptide AmyQ gene, six histidine genes, thioredoxin gene and enterokinase cleavage site gene were fused upstream of the porcine antimicrobial peptide PR39 gene. The specific genes are as follows:

[0020] GCGGAATTC atgatccaaaaacgtaaacgtacagtttctttccgtcttgttcttatgtgcacacttcttttcgtttctcttcctatcacaaaaacatctgct cgtcgtcgtcctcgtcctccttaccttcctcgtcctcgtcctcctcctttcttccctcctcgtcttcctcctcgtatccctcctggcttccctcctcgtttccctcctcgtttccct GGATCC

[0021] Among them, the underline is the restriction endonuclease cut site, the italic is the enterokinase cut site, the dotted line is the histidine tag, the double underline is the thioredoxin coding gene, and the bold capital is the stop codon TAA.

[0022] The entire fusion gene AmyQ-6×His-Thioredoxin-Enterokinasesite-PR39 was synthes...

Embodiment 2

[0023] The construction of embodiment 2 recombinant expression vector

[0024] The synthesized cloning vector and expression vector pGJ148 containing the above-mentioned target fragments were subjected to BamHI and EcoRI double enzyme digestion respectively, and then the target fragments were recovered and ligated. The ligation product was transformed into Bacillus subtilis WB800N by chemical method, the plasmid was extracted, and positive clones were screened by restriction enzyme digestion and sequencing. The result is as Figure 1-Figure 2 shown. The correctly identified positive plasmid was named pAN39.

Embodiment 3

[0025] The expression of embodiment 3 target protein and the purification of recombinant antimicrobial peptide PR39

[0026] The screened positive clones were inoculated into LB medium for fermentation and expression, and the obtained recombinant antimicrobial peptide PR39 was purified by Ni-NTA affinity chromatography column, and then digested with enterokinase, then qualitatively analyzed by Tricine-SDS-PAGE, Coomassie bright blue quantitative analysis and mass spectrometry.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant swine-origin antibacterial peptide as well as a preparation method and application thereof. The sequence of the recombinant swine-origin antibacterial peptide PR39 is as shown in the sequence table Seq No.1. The preparation method comprises the following steps: carrying out artificial synthesis of a PR39 fusion gene segment according to a gene engineering method, and successfully expressing the recombinant antibacterial swine-origin peptide PR39 in bacillus subtilis. Further researches show that the recombinant antibacterial swine-origin peptide PR39 can obviously inhibit the growth of gram-negative bacteria. The recombinant swine-origin antibacterial peptide is micro-molecular polypeptide of wide broad-spectrum antibacterial activity, and has various biological activities such as promoting occlusion and blood vessel generation and reducing inflammatory response.

Description

technical field [0001] The invention belongs to the field of agricultural, animal husbandry and veterinary applications, and relates to a recombinant pig-derived antimicrobial peptide and its preparation method and application. Background technique [0002] With the continuous application of antibiotics in feed production and animal breeding, many problems have emerged one after another. For example, the long-term use of antibiotic additives leads to the emergence of drug-resistant pathogenic bacteria. A public health crisis not to be faced. Therefore, there is an urgent need to develop a new type of safe antibacterial substance as a feed additive to replace antibiotics and add it to feed, so as to prevent animal diseases, promote animal growth, and reduce feeding costs. Recombinant peptide PR39 is a porcine antibacterial peptide expressed recombinantly, containing 39 amino acid residues. It is not only a small molecular polypeptide with broad-spectrum antibacterial activi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/47C12N15/75A61K38/17A61P31/04
CPCA61K38/00C07K14/47
Inventor 单安山王珏
Owner NORTHEAST AGRICULTURAL UNIVERSITY