Method for preparing brain natriuretic peptide precursor antigen substitute based on human-derived skeleton protein Fn3

A skeleton protein and brain natriuretic peptide technology, applied in chemical instruments and methods, using vectors to introduce foreign genetic material, expression enhancement stability/folded protein fusion, etc., can solve the problems of small molecules, difficult expression and purification, etc., and achieve high-efficiency expression Effect

Active Publication Date: 2016-06-15
DALIAN UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the epitope is generally composed of only a few to a dozen amino acids, it is extremely difficult to express and purify a single antigenic epitope peptide due to its small size

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing brain natriuretic peptide precursor antigen substitute based on human-derived skeleton protein Fn3
  • Method for preparing brain natriuretic peptide precursor antigen substitute based on human-derived skeleton protein Fn3
  • Method for preparing brain natriuretic peptide precursor antigen substitute based on human-derived skeleton protein Fn3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] 1. In this example, human fibronectin type III domain (Fn3) protein is used as a model gene (EMBL accession number AJ320527). At the 5′ end of the gene, 6 histidine residues were introduced, and a short peptide sequence encoding NT-proBNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding 12-21 amino acid residues LETSGLQEQR of NT-proBNP) was introduced into the FGloop region. The fusion gene structure See figure 1 .

[0024] After the human fibronectin type III domain (Fn3) shown in the sequence table [001] and the NT-proBNP fusion gene expression cassette sequence were synthesized (Nanjing Jinsirui Biotechnology Co., Ltd.), construct Escherichia coli with NcoI and HindIII On the expression vector pET28a(+), the recombinant vector pET28-Fn3-epitope was obtained. For the vector structure, see figure 2 .

[0025] 2. Electric shock transformation of the constructed expression vector into BL21 (DE3) Escherichia coli strain, and then inoculate the transformants into 10 m...

Embodiment 2

[0029] 1. In this example, human fibronectin type III domain (Fn3) protein is used as a model gene (EMBL accession number AJ320527). At the 5′ end of the gene, 6 histidine residues were introduced, and a short peptide sequence encoding NT-proBNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding 12-21 amino acid residues LETSGLQEQR of NT-proBNP) was introduced into the FGloop region. The fusion gene structure See figure 1 .

[0030] After the human fibronectin type III domain (Fn3) shown in the sequence table [001] and the NT-proBNP fusion gene expression cassette sequence were synthesized (Nanjing Jinsirui Biotechnology Co., Ltd.), construct Escherichia coli with NcoI and HindIII On the expression vector pET28a(+), the recombinant vector pET28-Fn3-epitope was obtained. For the vector structure, see figure 2 .

[0031] 2. Electric shock transformation of the constructed expression vector into BL21 (DE3) Escherichia coli strain, and then inoculate the transformants into 10 m...

Embodiment 3

[0035] 1. In this example, human fibronectin type III domain (Fn3) protein is used as a model gene (EMBL accession number AJ320527). At the 5′ end of the gene, 6 histidine residues were introduced, and a short peptide sequence encoding NT-proBNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding 12-21 amino acid residues LETSGLQEQR of NT-proBNP) was introduced into the FGloop region. The fusion gene structure See figure 1 .

[0036] After the human fibronectin type III domain (Fn3) shown in the sequence table [001] and the NT-proBNP fusion gene expression cassette sequence were synthesized (Nanjing Jinsirui Biotechnology Co., Ltd.), construct Escherichia coli with NcoI and HindIII On the expression vector pET28a(+), the recombinant vector pET28-Fn3-epitope was obtained. For the vector structure, see figure 2 .

[0037] 2. Transform the Escherichia coli strain BL21 (DE3) by electroporation with the constructed expression vector, then inoculate the transformant into 10 millil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a brain natriuretic peptide precursor N-terminal (NT-proBNP) linear epitope by displaying an antigenic epitope through human-derived skeleton protein Fn3 (human fibronectin 3). According to the method, through genetic recombination, an antigenic epitope nucleotide sequence capable of being combined with an anti-brain-natriuretic-peptide precursor antigen is used for replacing a nucleotide sequence in an encoding FG region of the skeleton protein Fn3, a fusion gene of the skeleton protein Fn3 and the NT-proBNP linear epitope is formed, an escherichia coli expression system is used for efficient expression, and fusion protein with the skeleton protein Fn3 and the NT-proBNP linear epitope fused is prepared. The method has the advantages that the fusion protein with antigenicity equivalent to that of a brain natriuretic peptide precursor can be easily, quickly and efficiently prepared, and a foundation is laid for efficiently preparing a standard substance with brain natriuretic peptide precursor antigenicity at low cost.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for expressing, separating and purifying human Fn3 to display the N-terminal (NT-proBNP) linear epitope of the antigen precursor brain natriuretic peptide (NT-proBNP). A fusion protein with comparable antigenicity to the body, that is, a pro-BNP antigen surrogate. It lays the foundation for the high-efficiency and low-cost preparation of standard products with pro-BNP antigenicity. Background technique [0002] During the preparation of the ELISA detection kit, the corresponding antigen is required as a standard. Among them, protein antigens account for a large proportion. How to efficiently produce protein-like antigenic proteins is a key technology for such products. The present invention adopts the human framework protein Fn3 to display the linear epitope of the protein antigen, and attempts to establish a general platform for efficiently producing the linear epitope of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/62C07K19/00
CPCC07K14/58C07K2319/21C07K2319/35
Inventor胡学军李梦阳丁宁杨春光孙慎侠马君燕曲鹏
OwnerDALIAN UNIV