Method for preparing brain natriuretic peptide precursor antigen substitute based on human-derived skeleton protein Fn3
A skeleton protein and brain natriuretic peptide technology, applied in chemical instruments and methods, using vectors to introduce foreign genetic material, expression enhancement stability/folded protein fusion, etc., can solve the problems of small molecules, difficult expression and purification, etc., and achieve high-efficiency expression Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] 1. In this example, human fibronectin type III domain (Fn3) protein is used as a model gene (EMBL accession number AJ320527). At the 5′ end of the gene, 6 histidine residues were introduced, and a short peptide sequence encoding NT-proBNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding 12-21 amino acid residues LETSGLQEQR of NT-proBNP) was introduced into the FGloop region. The fusion gene structure See figure 1 .
[0024] After the human fibronectin type III domain (Fn3) shown in the sequence table [001] and the NT-proBNP fusion gene expression cassette sequence were synthesized (Nanjing Jinsirui Biotechnology Co., Ltd.), construct Escherichia coli with NcoI and HindIII On the expression vector pET28a(+), the recombinant vector pET28-Fn3-epitope was obtained. For the vector structure, see figure 2 .
[0025] 2. Electric shock transformation of the constructed expression vector into BL21 (DE3) Escherichia coli strain, and then inoculate the transformants into 10 m...
Embodiment 2
[0029] 1. In this example, human fibronectin type III domain (Fn3) protein is used as a model gene (EMBL accession number AJ320527). At the 5′ end of the gene, 6 histidine residues were introduced, and a short peptide sequence encoding NT-proBNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding 12-21 amino acid residues LETSGLQEQR of NT-proBNP) was introduced into the FGloop region. The fusion gene structure See figure 1 .
[0030] After the human fibronectin type III domain (Fn3) shown in the sequence table [001] and the NT-proBNP fusion gene expression cassette sequence were synthesized (Nanjing Jinsirui Biotechnology Co., Ltd.), construct Escherichia coli with NcoI and HindIII On the expression vector pET28a(+), the recombinant vector pET28-Fn3-epitope was obtained. For the vector structure, see figure 2 .
[0031] 2. Electric shock transformation of the constructed expression vector into BL21 (DE3) Escherichia coli strain, and then inoculate the transformants into 10 m...
Embodiment 3
[0035] 1. In this example, human fibronectin type III domain (Fn3) protein is used as a model gene (EMBL accession number AJ320527). At the 5′ end of the gene, 6 histidine residues were introduced, and a short peptide sequence encoding NT-proBNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding 12-21 amino acid residues LETSGLQEQR of NT-proBNP) was introduced into the FGloop region. The fusion gene structure See figure 1 .
[0036] After the human fibronectin type III domain (Fn3) shown in the sequence table [001] and the NT-proBNP fusion gene expression cassette sequence were synthesized (Nanjing Jinsirui Biotechnology Co., Ltd.), construct Escherichia coli with NcoI and HindIII On the expression vector pET28a(+), the recombinant vector pET28-Fn3-epitope was obtained. For the vector structure, see figure 2 .
[0037] 2. Transform the Escherichia coli strain BL21 (DE3) by electroporation with the constructed expression vector, then inoculate the transformant into 10 millil...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com