Supercharge Your Innovation With Domain-Expert AI Agents!

Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit

An identification method and technology of source components, which are applied in the field of primer systems and PCR identification methods and kits, can solve the problems of less species coverage, narrow detection range, and great influence on sensitivity and extraction efficiency.

Pending Publication Date: 2016-07-06
JIANGSU INST OF POULTRY SCI
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In recent years, the design of species-specific primers and the establishment of PCR and real-time fluorescent PCR methods based on the differential sites of mitochondrial genomic DNA sequences have been reported abroad, but only a few domestic literatures have reported the use of PCR technology to identify meat sources. And most of its amplified sequences are based on microsatellite sequences in animal genomes. The sensitivity of the method is greatly affected by the extraction efficiency of genomic DNA, and the coverage of the species involved is small, and the detection range is narrow. The detection of bovine-derived, sheep-derived or porcine-derived components in this product still needs further verification
[0005] At present, there is no relevant report on the establishment of a method for the identification of pig, cattle and sheep-derived components in livestock and poultry meat based on the mitochondrial DNA16SrRNA gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit
  • Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit
  • Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Design of specific primer system: According to the nine animal mitochondrial DNA 16SrRNA gene sequences of pig, cow, sheep, rabbit, pigeon, quail, chicken, duck and goose published on GenBank, through BLAST analysis, specific bases for each species The specific primer pairs for pigs, cattle, and sheep were screened out using Primer Premier 5.0 software. Each primer is described below:

[0050] Primer pair I for amplifying porcine 16S rRNA gene to generate porcine-specific amplified fragments:

[0051] The forward primer sequence is: CTCAACAAATTCACCAACAT (SEQ ID NO.1),

[0052] The reverse primer sequence is: GTGCGAGGAGAAAGGC (SEQ ID NO.2);

[0053] Primer pair II for amplifying the bovine 16SrRNA gene to generate bovine-specific amplified fragments:

[0054] The forward primer sequence is: AAGGAATAACAACAATCTC (SEQ ID NO.3),

[0055] The reverse primer sequence is: AGTGATTTGACTTGTGGG (SEQ ID NO.4);

[0056] Primer pair Ⅲ for amplifying sheep 16S rRNA gene to generat...

Embodiment 2

[0060] (1) Extraction of total DNA from muscles of various species: Fully mash and mix fresh pork, beef, mutton, rabbit, pigeon, quail, chicken, duck and goose, and use the above-mentioned centrifugal column type tissue genomic DNA extraction The extraction kit extracts DNA, and the extracted total DNA samples are respectively dissolved in 100ul eluent TE, detected by 1% agarose gel electrophoresis, and the absorbance values ​​at 260nm and 280nm are measured by a nucleic acid protein analyzer, and the DNA concentration and purity are calculated, - Store at 20°C for later use.

[0061] (2) Using the 3 pairs of primers in Example 1, the above-mentioned pork, beef, and mutton DNA were used as templates, and other animal muscle DNA was used as a control, and nucleic acid-free double-steamed sterilized water was used as a negative control to establish a PCR detection system. .

[0062] (3) Preparation of 20 μL reaction system: 2×PCRMix 10ul, 10 μmol / L forward primer pair I or prim...

Embodiment 3

[0070] Using the mixed total DNA sample of the total DNA samples of each species mixed according to a certain ratio as a template:

[0071] (1) Treatment of mixed total DNA samples: Mix equal volumes of total DNA samples from nine animals in Example 2, in which each animal muscle DNA accounts for 0.1 volume, and mix with 0.1 volume of double-distilled sterilized water, as Mix DNA templates.

[0072] (2) Using the 3 pairs of primers in Example 1, using the mixed DNA as a template, using 9 kinds of animal muscle DNA as a control, and using double-distilled sterilized water without nucleic acid as a negative control, a PCR detection system was established.

[0073] (3) Preparation of 20 μL reaction system: 2×PCRMix 10ul, 10 μmol / L forward primer pair I or primer pair II or primer pair III 0.3 μL, 10 μmol / L reverse primer pair I or primer pair II or primer pair III 0.3 μL , mixed DNA template 1 μL, double-distilled sterilized water 8.4 μL.

[0074] (4) Formulation of the PCR rea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer system for identifying components derived from pigs, cattle and sheep in livestock and poultry meat, a PCR identification method and a kit. Design specific primers according to the differential sites of animal mitochondrial DNA 16S rRNA genes, see sequence list SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6. The PCR identification method includes extracting the DNA of the sample to be tested and PCR amplification. A kit comprising SEQ ID NO.1‑6. The primers of the present invention only specifically amplify the target fragments of their respective species, and will not react with other species. The detection sensitivity is high, and the components derived from pigs, cattle, and sheep in livestock and poultry meat can be effectively identified. The method is rapid , sensitive and practical; if the primer system is combined with relevant reagents, it can be made into a kit, which provides the possibility for industrial production and application, and has a good application prospect.

Description

technical field [0001] The invention belongs to the field of molecular biology, and specifically relates to a primer system, a PCR identification method and a kit for the pig, cattle, and sheep-derived PCR identification in livestock and poultry meat, and is suitable for the rapid detection and identification of the above-mentioned three kinds of animal meat. identification. Background technique [0002] The quality and safety of meat and meat products has always been a hot topic of concern to the whole society. With the widening price gap between pork, beef, and mutton in the market, some unscrupulous businesses or individuals use relatively cheap pork to sell it as beef and mutton products through various means of deep processing in order to pursue their own interests, seriously infringing on consumption. The legitimate rights and interests of consumers directly affect the health of consumers. In recent years, with the multiple exposures of "beef paste", fake beef, mutto...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888
Inventor 唐修君高玉时樊艳凤张晶鑫贾晓旭张小燕葛庆联唐梦君顾荣刘茵茵蒲俊华陈大伟张静马丽娜黄胜海
Owner JIANGSU INST OF POULTRY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More