Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit
An identification method and technology of source components, which are applied in the field of primer systems and PCR identification methods and kits, can solve the problems of less species coverage, narrow detection range, and great influence on sensitivity and extraction efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Design of specific primer system: According to the nine animal mitochondrial DNA 16SrRNA gene sequences of pig, cow, sheep, rabbit, pigeon, quail, chicken, duck and goose published on GenBank, through BLAST analysis, specific bases for each species The specific primer pairs for pigs, cattle, and sheep were screened out using Primer Premier 5.0 software. Each primer is described below:
[0050] Primer pair I for amplifying porcine 16S rRNA gene to generate porcine-specific amplified fragments:
[0051] The forward primer sequence is: CTCAACAAATTCACCAACAT (SEQ ID NO.1),
[0052] The reverse primer sequence is: GTGCGAGGAGAAAGGC (SEQ ID NO.2);
[0053] Primer pair II for amplifying the bovine 16SrRNA gene to generate bovine-specific amplified fragments:
[0054] The forward primer sequence is: AAGGAATAACAACAATCTC (SEQ ID NO.3),
[0055] The reverse primer sequence is: AGTGATTTGACTTGTGGG (SEQ ID NO.4);
[0056] Primer pair Ⅲ for amplifying sheep 16S rRNA gene to generat...
Embodiment 2
[0060] (1) Extraction of total DNA from muscles of various species: Fully mash and mix fresh pork, beef, mutton, rabbit, pigeon, quail, chicken, duck and goose, and use the above-mentioned centrifugal column type tissue genomic DNA extraction The extraction kit extracts DNA, and the extracted total DNA samples are respectively dissolved in 100ul eluent TE, detected by 1% agarose gel electrophoresis, and the absorbance values at 260nm and 280nm are measured by a nucleic acid protein analyzer, and the DNA concentration and purity are calculated, - Store at 20°C for later use.
[0061] (2) Using the 3 pairs of primers in Example 1, the above-mentioned pork, beef, and mutton DNA were used as templates, and other animal muscle DNA was used as a control, and nucleic acid-free double-steamed sterilized water was used as a negative control to establish a PCR detection system. .
[0062] (3) Preparation of 20 μL reaction system: 2×PCRMix 10ul, 10 μmol / L forward primer pair I or prim...
Embodiment 3
[0070] Using the mixed total DNA sample of the total DNA samples of each species mixed according to a certain ratio as a template:
[0071] (1) Treatment of mixed total DNA samples: Mix equal volumes of total DNA samples from nine animals in Example 2, in which each animal muscle DNA accounts for 0.1 volume, and mix with 0.1 volume of double-distilled sterilized water, as Mix DNA templates.
[0072] (2) Using the 3 pairs of primers in Example 1, using the mixed DNA as a template, using 9 kinds of animal muscle DNA as a control, and using double-distilled sterilized water without nucleic acid as a negative control, a PCR detection system was established.
[0073] (3) Preparation of 20 μL reaction system: 2×PCRMix 10ul, 10 μmol / L forward primer pair I or primer pair II or primer pair III 0.3 μL, 10 μmol / L reverse primer pair I or primer pair II or primer pair III 0.3 μL , mixed DNA template 1 μL, double-distilled sterilized water 8.4 μL.
[0074] (4) Formulation of the PCR rea...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com