Unlock instant, AI-driven research and patent intelligence for your innovation.

Bladder cancer detection kit and method and application of human complement factor H related protein therein

A technology for detecting kits and complement factors, which is applied in the field of biomedicine, can solve the problems of low sensitivity, easy missed detection of C1 tumors, and inability to diagnose patient compliance in the early stage, so as to achieve high sensitivity, improve detection accuracy, and specificity Good results

Active Publication Date: 2016-07-20
HEBEI TEWENTE BIOTECH DEV CO LTD
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Urine exfoliative cytology has high specificity but low sensitivity, especially C1 grade tumors (BTA90%) are easily missed
However, cystoscopy is an invasive examination, which cannot be diagnosed early and has poor patient compliance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bladder cancer detection kit and method and application of human complement factor H related protein therein
  • Bladder cancer detection kit and method and application of human complement factor H related protein therein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] A bladder cancer detection kit, including polyclonal antibodies, using human complement factor H to construct a recombinant plasmid pET32a-CFH, using BL21(DE3) as an expression host for protein expression, and using ?KTA system for protein purification to obtain prokaryotic expression of BTA protein, immunized New Zealand white rabbits, and obtained polyclonal antibodies.

[0021] When constructing the recombinant plasmid, use GenBank number CAA68704.1 as a template, and use PrimerPremier5 to design primers: the forward primer is agacttctagcaaagattat, and the reverse primer is Tctttttgcacaagttggat.

[0022] The polyclonal antibody was labeled with horseradish peroxidase as an enzyme-labeled antibody, and the concentration of the polyclonal antibody was 7.5 μg / mL.

[0023] The kit also includes monoclonal antibodies, select three synthetic polypeptides in the amino acid sequence of BTA, and respectively immunize BALB / c female 6-week-old healthy mice with the polypeptides...

Embodiment 2

[0027] Samples were detected with the kit of Example 1.

[0028] (1) Drawing of standard curve

[0029] Take out the coated plate in the kit, and after returning to room temperature for 30 minutes, take 10 detection wells, and add 100 microliters of standard substance to each well. Specifically, normal urine is used as a blank, and 0U / ml, 0.5U / ml, 0.5U / ml, and 1U / ml, 2U / ml, 4U / ml, 8U / ml, 16U / ml, 32U / ml standard BTA, incubate in a 37°C incubator for 40min, wash the detection plate 3 times, add 100 microliters of enzyme to each well Label the antibody, incubate at 37°C for 25 minutes, wash the detection plate 5 times, add 100 μl of chromogenic solution to each well, incubate at 37°C for 10 minutes, add 50 μl of stop solution to each well, and place on a microplate reader The results were detected at 450nm, and a standard curve was drawn. see details figure 1 .

[0030] (2) Detection of samples

[0031] Take out the coated plate in the kit, recover to room temperature for 30...

Embodiment 3

[0034] Case surveillance in a hospital in Hebei

[0035] From December 2014 to June 2015, a total of 66 patients visited a hospital because of hematuria (53 cases) or other complaints.

[0036] There were 66 cases in this group, 50 males and 16 females, aged 20-88 years.

[0037] All patients underwent routine preoperative examinations and imaging examinations such as B-ultrasound, CT or CTU after admission.

[0038] The urine samples of all patients were taken before cystoscopy, and carried out the detection of the BTA kit of the present invention.

[0039] 35 positive cases: including 25 cases of urothelial tumors (16 cases of bladder cancer, 5 cases of renal pelvic tumors, 4 cases of ureteral tumors); 3 cases of bladder epithelial papillary hyperplasia with abnormal growth, 3 cases of ureteral calculi, 2 cases of urinary tract infection, There was 1 case of chyluria, and 1 case of hydronephrosis after total cystectomy; this kit was strongly positive.

[0040] Weakly posi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bladder cancer detection kit and method. A monoclonal antibody and a polyclonal antibody which are formed through the human complement factor H are involved. The invention further relates to application of human complement factor H related protein. BTA is selected as a marker for detecting bladder cancer, three different monoclonal antibodies obtained from polypeptide immune are mixed to be used as a coating antibody, the sensitivity is high, and specificity is high. The coating antibody and a detection antibody are obtained from antigen immune of different sources, and then detection accuracy is improved. The bladder cancer detection kit and method are high in detection precision, good in specificity, high in patient compliance and capable of achieving detection conveniently.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a bladder cancer detection kit, a detection method and the application of human complement factor H-related protein therein. Background technique [0002] Human complement factor H-related protein (humancomplementfactorHrelatedprotein, HCFHrp), also known as bladder tumor antigen (Bladdertumorantigen, BTA), complement factor H (ComplementFactorH) is its specific component, complement factor H is produced by cancer cells and macrophages, not Produced by normal epidermal cells, tumor cells secrete endogenous basal proteins to bind to basement membrane surface protein receptors, and release proteolytic enzymes to destroy the basement membrane, and basement membrane fragments (collagen fragments, glycoproteins, and proteoglycans, etc.) enter the bladder to aggregate into a polymer complex that is BTA. The size is 16 ~ 165kd, excreted with urine, and can be detected as bladder ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68G01N33/577G01N33/574
CPCG01N33/57407G01N33/57484G01N33/577G01N33/68G01N2333/47
Inventor 邢志祺齐颖颖
Owner HEBEI TEWENTE BIOTECH DEV CO LTD