Unlock instant, AI-driven research and patent intelligence for your innovation.

Glycerol dehydratase gene resistant to oxygen and glycerin and application thereof

A glycerol dehydratase, gene technology, applied in the application, genetic engineering, carbon-oxygen lyase and other directions, can solve the problem of reducing the enzymatic activity of glycerol dehydratase, and achieve the effect of high catalytic activity

Inactive Publication Date: 2016-09-21
TSINGHUA UNIV +1
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The presence of oxygen also significantly reduces the activity of glycerol dehydratase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glycerol dehydratase gene resistant to oxygen and glycerin and application thereof
  • Glycerol dehydratase gene resistant to oxygen and glycerin and application thereof
  • Glycerol dehydratase gene resistant to oxygen and glycerin and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Expression of glycerol dehydratase gene dhaB1B2 derived from Rhizobium japonicus and verification of its catalytic performance

[0027] Using the genome of Rhizobium loti as a template, PCR was performed with primers dhaB-F (AAGCTTGTCGACGGAGCTCGAATTCTCAGAAGCGGAATGTGAAAAGGCC) and dhaB-R (CTGGTGCCGCGCGGCAGCCATATGatgACGCCGAAACTGAACCG) to obtain about 2.7kb of the dhaB1B2 gene and purify the PCR product. The dhaB1B2 gene only contains 2 subunits, α subunit and β subunit, dhaB1 gene is α subunit, its nucleotide sequence is shown in SEQ ID NO.1, dhaB2 gene is β subunit, its nucleotide sequence As shown in SEQ ID NO.2.

[0028] Using the genome of Klebsiella pneumoniae HR526 (Klebsiella pneumoniae) as a template, PCR was carried out with primers gld-F (AAGCTTGTCGACGGAGCTCGAATTCTTAGCTTCCTTTACGCAGCTTATGC) and gld-R (CTGGTGCCGCGCGGCAGCCATATGatgAAAAAGATCAAAACGATTTGCAGTACTGG) as primers to obtain a gldABC gene product of about 2.0 kb and purified by PCR.

[0029] The exp...

Embodiment 2

[0035] Embodiment 2 utilizes the glycerol dehydratase gene derived from Rhizobium japonicum to improve the output of 1,3-propanediol

[0036] The pET-dhaB1B2 and pET-gldABC of Example 1 were digested with NdeI and EcoRI respectively and then ligated to the plasmid pEC-K18 (purchased from Addgene), and the obtained plasmids were named pEC-dhaB1B2 and pEC-gldABC. pEC-dhaB1B2 and pEC-gldABC were respectively electrotransformed into Klebsiella pneumoniae HR526 (electroporation conditions were voltage 1.8KV, 1mm electroporation cup), and the recombinant bacteria were obtained by screening on 50mg / L kanamycin LB plate, They were named Kp / pEC-dhaB1B2 and Kp / pEC-gldABC, respectively.

[0037] The wild-type Klebsiella pneumoniae HR526 and the two recombinant strains were respectively cultured in the fermentation medium for 48 hours (37° C., 150 rpm), and the production of 1,3-propanediol was detected. The composition of the fermentation medium is (g / L): glycerol 30, (NH 4 ) 2 SO 4 ...

Embodiment 3

[0039] Example 3 Utilization of the glycerol dehydratase gene derived from Rhizobium japonicum to increase the production of 3-hydroxypropionic acid

[0040] Using the genome of Escherichia coli K12 as a template, PCR was performed with primers aldH-F (tgcatgcctgcaggtcgactCTGACGTTCACAAACTGCATATATCTGATAGAC) and aldH-R (TATATCTCCTTtcaGGCCTCCAGGCTTATCCA) as primers to obtain and purify the aldH fragment of the 3-hydroxypropionate dehydrogenase gene (sequence shown in seq 3 Show).

[0041] The aldH gene was connected to the pET-dhaB1B2 and pET-gldABC prepared in Example 1 using the Gibson Assembly kit (NEB), respectively, and the obtained recombinant plasmids were named pET-dhaB1B2-aldH and pET-gldABC-aldH. These two plasmids were further transformed into Escherichia coli BL21 (DE3) by chemical transformation method, and the recombinant bacteria were obtained by screening on 50mg / L kanamycin LB plate, named BL21 / pET-dhaB1B2-aldH and BL21 / pET-dhaB2-aldH respectively. BL21 / pET-gldA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a glycerol dehydratase gene resistant to oxygen and glycerin and application thereof. The glycerin dehydratase gene dhaB1B2 derives from lotaustralin root nodule bacteria and only includes two subunits including a big alpha subunit and a small beta subunit, and nucleotide sequences of the subunits are shown as SEQ ID NO.1-2. The glycerin dehydratase gene dhaB1B2 has very high catalytic activity, and the enzyme activity inhibiting effect on the glycerin and the oxygen is far lower than those of other existing known B12-dependent glycerol dehydratases. In addition, the glycerol dehydratase gene can remarkably increase the yields of 1,3-propylene glycol and 3-hydracrylic acid and has a broad application prospect.

Description

technical field [0001] The invention belongs to the field of genetic engineering and biological fermentation, and in particular relates to a glycerol dehydratase gene with tolerance to oxygen and glycerin and its application. Background technique [0002] Glycerol dehydratase is a kind of dehydratase that specifically catalyzes the dehydration of glycerol or 1,2-propanediol to 3-hydroxypropionaldehyde or propionaldehyde, and is also the first key to catalyze the synthesis of 1,3-propanediol and 3-hydroxypropionate from glycerol enzyme. Glycerol is catalyzed by glycerol dehydratase to first produce 3-hydroxypropionaldehyde, which is reduced to 1,3-propanediol by alcohol dehydrogenase, or oxidized to 3-hydroxypropionate by aldehyde dehydrogenase . 1,3-propanediol is an important diol, which is mainly used as a monomer to polymerize with terephthalic acid to produce a new type of polyester material, polytrimethylene terephthalate (PTT). 3-Hydroxypropionic acid is an importan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N9/88C12P7/18C12P7/42
CPCC12N9/88C12P7/18C12P7/42C12Y402/0103
Inventor 陈振刘德华
Owner TSINGHUA UNIV