Supercharge Your Innovation With Domain-Expert AI Agents!

RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) detection primer group, RT-LAMP detection method and RT-LAMP detection kit for melon yellow spot virus

A RT-LAMP, detection kit technology, applied in the directions of microorganism-based methods, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of time-consuming, insufficient detection sample sensitivity, and narrow reaction temperature range. The effect of reducing losses and simplifying disease diagnosis and treatment

Active Publication Date: 2016-12-14
INST OF PLANT PROTECTION GUANGXI ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the detection of melon yellow spot virus mainly includes electron microscopy, molecular biology, serology, and biological inoculation. These methods either need to be equipped with expensive instruments (PCR, electron microscope, etc.), or are time-consuming.
[0004] The patent document with the notification number CN 104805219A has published "A Specific RT-LAMP Primer Set for Detecting Melon Yellow Spot Virus and Its RT-LAMP Detection Kit and RT-LAMP Detection Method", which provides a new method for Melon Yellow Spot Virus. A relatively simple and rapid detection method, but the primer set provided by this method is a degenerate primer, the specificity is not high, the reaction temperature range is narrow, and the sensitivity of the detection sample is not high enough

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) detection primer group, RT-LAMP detection method and RT-LAMP detection kit for melon yellow spot virus
  • RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) detection primer group, RT-LAMP detection method and RT-LAMP detection kit for melon yellow spot virus
  • RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) detection primer group, RT-LAMP detection method and RT-LAMP detection kit for melon yellow spot virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Design of RT-LAMP primers for Melon Yellow Spot Virus.

[0033] According to the N gene sequence of melon yellow spot virus (KX118633) reported on NCBI, combined with the sequencing results of melon yellow spot virus, VECTOR NTI alignX was used for comparison and analysis, and the conserved region of the gene sequence 2366nt-3136nt (the whole genome of the virus was selected) long position), use the online primer design software Primer Explorer V4 to design primers, and finally select the following RT-LAMP detection primer set:

[0034] Outer primer pair F3 and B3:

[0035] Upstream primer F3: GTATGGTTTAACTGTGCCTG (see SEQ ID No.1 in the sequence listing);

[0036] Downstream primer B3: TGCTAGCAGACATAACACG (see SEQ ID No. 2 in the sequence listing).

[0037] Inner primer pair FIP and BIP:

[0038] Upstream primer FIP:

[0039] CTGCCTTTGGCCTATTTTCAGAATAATTTTGCAGATCTGCTCAT (see SEQ ID No.3 in the sequence listing);

[0040] Downstream primer BIP:

[0041] ACTAGCAAGC...

Embodiment 2

[0043] Establishment of RT-LAMP reaction system for melon yellow spot virus.

[0044] By setting the primer ratio of the outer primer pair F3 / B3 and the inner primer pair FIP / BIP with different final concentrations, the combination is determined to be 0.2uM:1.6uM, and the temperature is 60°C and 61°C by comparing experiments at different temperatures , 62°C, 63°C, 64°C, 65°C, for the electropherogram results of RT-LAMP amplification results under different reaction temperature conditions, see figure 1 As shown, the optimal reaction parameters were optimized to establish a detection system for melon yellow spot virus. The optimized 25 μL reaction system is shown in Table 1.

[0045] Table 1 Optimized RT-LAMP reaction system for melon yellow spot virus

[0046] RT-LAMP-MgSO 4 buffer

4μL

F3 primer (final concentration 0.2um)

0.5μL

B3 primer (final concentration 0.2um)

0.5μL

FIP primer (final concentration 1.6um)

4μL

BIP prim...

Embodiment 3

[0050] RT-PCR and RT-LAMP sensitivity experiments.

[0051] In order to determine the sensitivity of the two methods of RT-PCR and RT-LAMP in the detection of melon yellow spot virus, the concentration (408.6ng / μL) of the extracted melon total RNA was measured by a spectrophotometer (NanoDrop 1000) (Thermo Scientific, USA). , and then use RNAase Free water to perform 10-fold dilution, and take 2 μL of the RNA multiple dilution solution as the template for the RT-LAMP reaction, and compare the RT-LAMP amplification experiments at different reaction times. The loop-mediated constant temperature amplification reaction time Respectively 30min, 45min, 60min, 75min, 90min, 120min, and the remaining parameters were reacted with reference to the reaction system of Example 2. After the reaction is completed, take 2 μL of the amplified product and run it on 1.2% agarose gel (adding 1.2‰ of gel-red fluorescent dye) for 60 min in 0.5x TAE electrophoresis buffer and 120V voltage. After the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides an RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) detection primer group, an RT-LAMP detection method and an RT-LAMP detection kit for a melon yellow spot virus. The RT-LAMP detection primer group for the melon yellow spot virus comprises an outer side primer pair F3 and B3 and an inner side primer pair FIP and BIP, wherein sequences of the primer pairs are shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4. According to the detection method provided by the invention, an LAMP reaction is performed by adopting the RT-LAMP detection primer group for the melon yellow spot virus, and then whether a to-be-detected sample is infected with the melon yellow spot virus or not is identified by using agarose gel electrophoresis or fluorescent staining. By adopting the RT-LAMP detection primer group and the detection method for the melon yellow spot virus, disclosed by the invention, diseases can be identified quickly, accurately, simply and conveniently, further proper prevention and control measures are adopted, and the loss brought by the diseases is reduced.

Description

technical field [0001] The invention belongs to the technical field of virus detection, and in particular relates to an RT-LAMP detection primer set, a detection method and a detection kit for melon yellow spot virus. Background technique [0002] Melon yellow spot virus (Melon yellow spot virus, MYSV) belongs to the Bunyaviridae (Bunyaviridae) tomato spotted wilt virus (Tospovirus), which is mainly transmitted naturally by persistent multiplication through palm thrips (Thrips palmiKarny). May spread mechanically through sap. Symptoms caused by the virus infecting the host are mainly systemic yellowing and necrotic spots on plants and fruit deformities. The virion is a sphere with an envelope, and the genome includes three single-stranded linear RNA fragments, namely L RNA, M RNA and S RNA; it mainly damages Cucurbitaceae crops such as melon, watermelon, cucumber and bitter melon. In 1992, MYSV first occurred in Japan, causing serious losses to local melons and cucumbers. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/94
Inventor 秦碧霞李战彪谢慧婷蔡健和苏琴崔丽贤邓铁军杨世安
Owner INST OF PLANT PROTECTION GUANGXI ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com