Unlock instant, AI-driven research and patent intelligence for your innovation.

A multiplex PCR detection kit for rapid identification of Salmonella Enteritidis, Salmonella pullorum/Salmonella gallinarum typhi and Salmonella Dublin

A technology of Salmonella typhi and detection kit, which is applied in the field of biotechnology detection, can solve the problems of pathogenic bacteria pollution, time-consuming, high false positive, etc., and achieve good repeatability

Active Publication Date: 2019-06-18
YANGZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Traditional detection methods, namely, non-selective and selective enrichment, biochemical characteristics and serological identification are laborious and time-consuming, and it takes 4-7 days to complete. Other methods, such as antibody detection, are fast, but their high false positives make them Not suitable for routine testing
In addition, factors such as low levels of pathogenic bacteria contamination, "injury" of Salmonella after food processing and interference from other food ingredients have limited the detection of Salmonella

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A multiplex PCR detection kit for rapid identification of Salmonella Enteritidis, Salmonella pullorum/Salmonella gallinarum typhi and Salmonella Dublin
  • A multiplex PCR detection kit for rapid identification of Salmonella Enteritidis, Salmonella pullorum/Salmonella gallinarum typhi and Salmonella Dublin
  • A multiplex PCR detection kit for rapid identification of Salmonella Enteritidis, Salmonella pullorum/Salmonella gallinarum typhi and Salmonella Dublin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Bioinformatics method to identify the distribution of tcpS gene, lygD gene and flhBinner gene

[0037] Use the Blastn online comparison software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) in NCBI to search for the tcpS gene, lygD gene and flhBinner gene in the genome-wide database. The search results show that only the tcpS gene exists In Salmonella enteritidis, pullorum and Salmonella gallisepticum and Salmonella gallisepticum and Salmonella dublin, the lygD gene is only present in Salmonella enteritidis, while the flhB gene of pullorum and Salmonella gallisepticum lacks intermediate flhB compared to other serotypes of Salmonella. Nucleotide fragments, that is, there is no flhB intermediate fragment flhBinner in pullorum and Salmonella typhi. According to the distribution characteristics of these three genes, these three serotypes of Salmonella can be distinguished ( figure 1 ).

Embodiment 2

[0038] Example 2 Preparation of kit

[0039] Primer design and synthesis: use tcpS gene, lygD gene and flhBinner gene as templates, design and analyze primers, and select the best primer pair for detection according to the genomic DNA sequence. Among them, tcpS primer amplifies its full-length sequence ( 882bp), lygD primer amplifies partial sequence (339bp), flhBinner primer amplifies the flhBinner fragment of non-pullaria and Salmonella gallisepticum. Its nucleotide sequence is shown in Table 1:

[0040] Table 1

[0041]

[0042] The nucleotide sequence of the tcpS gene that can be amplified by the tcpS primer is shown in SEQ ID NO. 7, specifically:

[0043] ATGTCTATAAGCACCACAATGTCAAATATCAACAGAATACAAAAAGACATTGCTAGTCTACAAAAACAACTTTCTGATGAGCAGCGTAAAGAGGCCCAACTTTCAGGAAAAATCAATCAAATAAAGCGTAGCGTCACTAAGTCAACGTCTTTAAGCACATTGAATTCCAAAATGTCAGAGATCTCTCGTCATAAAAATGATATTTCAAGATGTAACTCTAAAAAAGCAGATATTAATAAAAAAATAACAGCAAAAACTGGAGACTTACACCGTTATCAATTACAACTCATTAAAGAGCAAGAGAATGACCAGAAAAAAAGAATTGCTGCA...

Embodiment 3

[0051] Example 3 The specific identification of the kit for detecting Salmonella enteritidis, Salmonella pullorum / Salmonella gallisepticum and Salmonella Dublin

[0052] Using the three sets of primer pairs in the kit described in Example 2, using the genomes of different serotypes of Salmonella and other bacteria as templates, the multiplex PCR method was used to detect Salmonella enteritidis, Salmonella pullorum / Salmonella gallisepticum and Salmonella dublin Specificity.

[0053] PCR reaction system (25μL): dNTP 2μL, 10×PCR buffer 2.5μL, tcpS-F 80nM, tcpS-R80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, template 2μL, rTaq enzyme 0.25μL, ddH 2 O make up to 25μL.

[0054] The PCR program is 94°C for 5min; 94°C for 45s, 55°C for 45s, 72°C for 40s, 30 cycles; 72°C for 10min.

[0055] The PCR products were subjected to 1% agarose gel electrophoresis. The results of PCR electrophoresis showed that the lanes using the Salmonella enteritidis genome as the template could...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology detection, and in particular relates to a multiplex PCR detection kit for rapid identification of Salmonella enteritidis, Salmonella pullorum / typhoid fever and Salmonella Dublin. The kit includes tcpS Gene detection primers, wxya Gene detection primers and flhBinner Gene detection primers. The kit of the present invention can quickly and high-throughput identify the serotypes of enteritis, pullorum / typhoid fever and Salmonella Dublin respectively, and can be used as an auxiliary method for the traditional serotyping of Salmonella, and provides a basis for the monitoring and monitoring of these three specific serotypes of Salmonella Laboratory diagnosis provides a new method that is simple, rapid and reproducible.

Description

Technical field [0001] The invention belongs to the field of biotechnology detection, and specifically relates to a multiple PCR detection kit for quickly identifying Salmonella enteritidis, Salmonella pullorum / Salmonella gallisepticum and Salmonella Dublin. Background technique [0002] Salmonellosis is one of the zoonotic diseases of great importance in public health. The pathogen Salmonella belongs to the Enterobacteriaceae family. Eggs, livestock and meat products are the main transmission vectors. It can not only cause a variety of livestock and poultry diseases, but also It can cause systemic sepsis and enteritis. It can also be the pathogen of food-borne diseases, causing human gastroenteritis and food poisoning. In my country, about 70% to 80% of bacterial food poisoning are caused by salmonella. At present, according to the Kauffman-White (KW) serotype classification method, according to the difference of Salmonella bacterial antigens and flagella antigens, there are mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/10C12Q1/04C12R1/42
CPCC12Q1/10C12Q1/686C12Q1/689C12Q2537/143
Inventor 焦新安潘志明熊丹宋丽焦扬安树敏耿士忠孙林陈祥黄金林殷月兰
Owner YANGZHOU UNIV