A multiplex PCR detection kit for rapid identification of Salmonella Enteritidis, Salmonella pullorum/Salmonella gallinarum typhi and Salmonella Dublin
A technology of Salmonella typhi and detection kit, which is applied in the field of biotechnology detection, can solve the problems of pathogenic bacteria pollution, time-consuming, high false positive, etc., and achieve good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Bioinformatics method to identify the distribution of tcpS gene, lygD gene and flhBinner gene
[0037] Use the Blastn online comparison software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) in NCBI to search for the tcpS gene, lygD gene and flhBinner gene in the genome-wide database. The search results show that only the tcpS gene exists In Salmonella enteritidis, pullorum and Salmonella gallisepticum and Salmonella gallisepticum and Salmonella dublin, the lygD gene is only present in Salmonella enteritidis, while the flhB gene of pullorum and Salmonella gallisepticum lacks intermediate flhB compared to other serotypes of Salmonella. Nucleotide fragments, that is, there is no flhB intermediate fragment flhBinner in pullorum and Salmonella typhi. According to the distribution characteristics of these three genes, these three serotypes of Salmonella can be distinguished ( figure 1 ).
Embodiment 2
[0038] Example 2 Preparation of kit
[0039] Primer design and synthesis: use tcpS gene, lygD gene and flhBinner gene as templates, design and analyze primers, and select the best primer pair for detection according to the genomic DNA sequence. Among them, tcpS primer amplifies its full-length sequence ( 882bp), lygD primer amplifies partial sequence (339bp), flhBinner primer amplifies the flhBinner fragment of non-pullaria and Salmonella gallisepticum. Its nucleotide sequence is shown in Table 1:
[0040] Table 1
[0041]
[0042] The nucleotide sequence of the tcpS gene that can be amplified by the tcpS primer is shown in SEQ ID NO. 7, specifically:
[0043] ATGTCTATAAGCACCACAATGTCAAATATCAACAGAATACAAAAAGACATTGCTAGTCTACAAAAACAACTTTCTGATGAGCAGCGTAAAGAGGCCCAACTTTCAGGAAAAATCAATCAAATAAAGCGTAGCGTCACTAAGTCAACGTCTTTAAGCACATTGAATTCCAAAATGTCAGAGATCTCTCGTCATAAAAATGATATTTCAAGATGTAACTCTAAAAAAGCAGATATTAATAAAAAAATAACAGCAAAAACTGGAGACTTACACCGTTATCAATTACAACTCATTAAAGAGCAAGAGAATGACCAGAAAAAAAGAATTGCTGCA...
Embodiment 3
[0051] Example 3 The specific identification of the kit for detecting Salmonella enteritidis, Salmonella pullorum / Salmonella gallisepticum and Salmonella Dublin
[0052] Using the three sets of primer pairs in the kit described in Example 2, using the genomes of different serotypes of Salmonella and other bacteria as templates, the multiplex PCR method was used to detect Salmonella enteritidis, Salmonella pullorum / Salmonella gallisepticum and Salmonella dublin Specificity.
[0053] PCR reaction system (25μL): dNTP 2μL, 10×PCR buffer 2.5μL, tcpS-F 80nM, tcpS-R80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, template 2μL, rTaq enzyme 0.25μL, ddH 2 O make up to 25μL.
[0054] The PCR program is 94°C for 5min; 94°C for 45s, 55°C for 45s, 72°C for 40s, 30 cycles; 72°C for 10min.
[0055] The PCR products were subjected to 1% agarose gel electrophoresis. The results of PCR electrophoresis showed that the lanes using the Salmonella enteritidis genome as the template could...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


