Development method of fluorescent protein transgenic zebra fish capable of highly sensitively monitoring water body PAHs by utilizing cascade amplification effect

A fluorescent protein and zebrafish technology, applied in the biological field, can solve problems such as the inability to transmit LUC reporter genes and the failure to monitor aromatic hydrocarbon pollutants, and achieve high sensitivity results

Active Publication Date: 2017-02-15
CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2001, Mattingly et al first confirmed that zebrafish transcription factors can recognize human AhREs and can drive the expression of GFP under the induction of TCDD, but they only studied the functions of aryl hydrocarbon receptors and their downstream genes, and did not apply them to In vivo monitoring of aromatic hydrocarbon pollutants
Since then, Nebert et al. used the promoter containing AhREs to drive the expression of LUC reporter gene, and developed transgenic zebrafish to detect aromatic hydrocarbon organic pollutants in water, but the LUC reporter gene in the transgenic zebrafish they developed could not be transmitted to F 2 generation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Development method of fluorescent protein transgenic zebra fish capable of highly sensitively monitoring water body PAHs by utilizing cascade amplification effect
  • Development method of fluorescent protein transgenic zebra fish capable of highly sensitively monitoring water body PAHs by utilizing cascade amplification effect
  • Development method of fluorescent protein transgenic zebra fish capable of highly sensitively monitoring water body PAHs by utilizing cascade amplification effect

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Construction of GAL4-UAS upstream response carrier capable of responding to polycyclic aromatic hydrocarbons in water environment

[0036] 1. Synthesis of polycyclic aromatic hydrocarbon response element AhREs:

[0037] A mutant of the AhREs sequence: TCCGGTCCTTCTCACGCAACGCCTGGG (SEQ ID NO.1) was selected as the basic element.

[0038] Artificially synthesized gene fragment NotI-NheI-AhREs-SpeI-M.EcoP15I-NcoI-TATA+-PstI with 3 copies in tandem in the same direction, including the corresponding restriction site and the downstream part of the TATA-box sequence:

[0039] 5'- GCGGCCGCGCTAGC TCCGGTCCTTCTCACGCAACGCCTGGGTCCGGTCCTTCTCACGCAACGCCTGGGTCCGGTCCTTCTCACGCAACGCCTGGG ACTAGTCAGCAGCCATGG TTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACC CTGCAG -3' (SEQ ID NO.2) (the underlined part is the restriction site, the bold is the 3-fold tandem AhREs mutant sequence, and the italic is the partial sequence of AhREs downstream TATA-box).

[0040] The artificially synthesized f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and in particular relates to a development method of fluorescent protein transgenic zebra fish capable of highly sensitively monitoring water body PAHs by utilizing the cascade amplification effect. According to the method, a UAS-Gal4 gene expression regulation system is taken as a basis, a multiring aromatic hydrocarbon response element AhREs after optimization and reorganization is utilized for driving the expression of the upstream plasmid Ga14, and further, the expression of the fluorescent gene eGFP in the downstream UAS plasmid is regulated; meanwhile, the TALE-TF transcriptional activation enhancement technology is innovatively combined, the expression quantity of the eGFP gene is further enhanced by utilizing the TALE transcriptional activation effect, and then the purpose of increasing the fluorescence signals through multiple ways is achieved; finally, the low-copy induced fluorescent protein transgenic zebra fish with stable inheritance is obtained by utilizing the I-SceI wide-range nuclease transfer system, and the influences on the toxicity of the zebra fish are small; by manufacturing the fluorescent protein transgenic zebra fish highly sensitive to the environmental pollutants, the toxic pollutants in the water body can be easily, efficiently, sensitively and intuitively monitored.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a method for developing fluorescent protein gene-transferred zebrafish by using cascade amplification effect to monitor water body PAHs pollutants with high sensitivity. Background technique [0002] At this stage, environmental pollution, especially water pollution, is widespread all over the world. Water pollution will not only affect the survival and reproduction of aquatic organisms, but also pollutants will reach the end of the food chain through bioaccumulation and concentration, seriously affecting human health. In recent years, people have frequently detected polycyclic aromatic hydrocarbons and other organic pollutants in the environment. Studies have shown that such pollutants have caused serious threats to the survival of organisms in the water environment, soil and sediments. Among them, the organic pollutants in the environmental water body are mainl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027G01N21/64G01N33/18
CPCA01K67/0278G01N21/6486G01N33/186C12N15/85C12N2800/80C12N2800/106A01K2217/203A01K2227/40A01K2267/0393Y02A20/20
Inventor裴得胜贺超谢少林马彦博
OwnerCHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI