Check patentability & draft patents in minutes with Patsnap Eureka AI!

Development and applications of heat shock induced Cas9 enzyme transgene danio rerio

A heat shock induction, zebrafish technology, applied in genetic engineering, the use of microinjection, the introduction of foreign genetic material using vectors, etc., can solve problems such as lack of gene editing methods

Inactive Publication Date: 2017-02-22
CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI
View PDF1 Cites 44 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the lack of effective gene editing methods in fish, the research on the function of MC4R gene in fish has just started

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Development and applications of heat shock induced Cas9 enzyme transgene danio rerio
  • Development and applications of heat shock induced Cas9 enzyme transgene danio rerio
  • Development and applications of heat shock induced Cas9 enzyme transgene danio rerio

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Obtaining the Cas9 enzyme expression vector pTol2-HSP70-Cas9-2A-eGFP

[0041] Utilize BamHI and SalI to cut the plasmid vector pTol2-CMV-eGFP (such as figure 2 shown), enzyme digestion system: 10xGreen Buffer 5ul, plasmid vector pTol2-CMV-eGFP 8.8ul (0.284ug / ul), BamHI 2.5ul, SalI2.5ul, add water to make up 50ul. The 7993bp fragment was recovered by agarose gel electrophoresis to obtain the backbone fragment pTol2.

[0042] The plasmid vector pISceI-HSP70-Cas9-2A-eGFP was digested by BamHI and SalI double enzymes (such as image 3 shown), enzyme digestion system: 10x Green Buffer 5ul, plasmid vector pISceI-HSP70-Cas9-2A-eGFP 7.7ul (0.321ug / ul), BamHI2.5ul, SalI 2.5ul, add water to make up 50ul. After the digestion was completed, the 6969bp fragment was recovered by agarose gel electrophoresis to obtain the insert fragment HSP70-Cas9-2A-eGFP.

[0043] The backbone fragment pTol2 and the insert fragment HSP70-Cas9-2A-eGFP were ligated. The ligation reaction ...

Embodiment 2

[0053] Example 2 Injection of Cas9 enzyme expression vector into zebrafish fertilized eggs

[0054] (1) Obtaining zebrafish fertilized eggs

[0055] Before fertilization, the male and female broodstock were separated and placed in the spawning box at a ratio of 1:1-2 for isolation culture. The egg-laying box was placed in a constant temperature environment of 26°C-29°C for overnight culture in the dark, and the photoperiod was 14h in daylight and 10h in darkness. At the end of the cultivation, the partition board was removed and the inner layer with the fence at the bottom was obliquely placed on the outer layer mating box, and placed in a constant temperature environment to obtain fertilized zebrafish eggs.

[0056] (2) Inject the Cas9 enzyme expression vector into zebrafish fertilized eggs

[0057] Using a microinjector and referring to the microinjection method, the Cas9 enzyme expression vector pTol2-HSP70-Cas9-2A-eGFP constructed in Example 1 (such as figure 1 shown) a...

Embodiment 3

[0063] The knockout of embodiment 3 zebrafish MC4R gene

[0064] (1) Determination of MC4R gene targeting sites and preparation of gRNA

[0065] Design the MC4R gene targeting site, select the appropriate targeting sequence according to the results given by the website (http: / / zifit.partners.org / favicon.ico), the targeting sequence selected by the present invention is shown in SEQ ID NO.1, specifically For: GGGGGTGTTTGTGGTGTGCT.

[0066] The present invention adopts the method of PCR to amplify the transcription template of gRNA. First, design primers according to the selected targeting sequence, the upstream primer sequence is as SEQ ID NO.2, specifically:

[0067] TAATACGACTCACTATAGGGGGTGTTTGTGGTGTGCTGTTTTAGGCTAGAAATAGC; the downstream primer sequence is shown in SEQ ID NO.3, specifically: AGCACCGACTCGGTGCCAC.

[0068]The plasmid containing the gRNA backbone is used as a template, and the backbone sequence is shown in SEQ ID NO.4, specifically: AGCTTGAAATTAATACGACTCACTATA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the technical field of biology, particularly to development and applications of a heat shock induced Cas9 enzyme transgene danio rerio. The present invention firstly provides a Cas9 enzyme expression vector, which utilizes a heat shock induced promoter HSP70 to drive the expression of a downstream Cas9 gene. According to the present invention, the Cas9 enzyme expression vector and Tol2 mRNA are co-injected into wild type danio rerio single cell fertilized egg, and selection is performed to obtain the heat shock induced Cas9 enzyme transgene danio rerio, such that the gene editing research of the CRISPR-Cas9 system in the danio rerio is successfully achieved, and the know-out of the MC4R gene in the transgene danio rerio is firstly achieved; and the Cas9 enzyme expression vector is further suitable for heat shock induced gene knockout, gene knock-in, gene expression modification and other applications of other fishes.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the development and application of a heat-shock-inducible Cas9 enzyme transgenic zebrafish. Background technique [0002] The zebrafish (Danio rerio) is a bony fish belonging to the genus Danio of the family Cyprinidae in the subclass Actinopterygii, because it has longitudinal dark blue and silver stripes like a zebra on the side of its body. named after the stripes. Zebrafish has a high degree of homology of 87% with human genes, which means that the results obtained using zebrafish as experimental animals can be applied to humans in most cases, so its advantages as a model organism are very prominent. Its juveniles have the characteristics of rapid reproduction, transparent eggs and juveniles, and are often used for monitoring water environment pollutants, making related disease models, and so on. Among them, the maturity of transgenic technology also brings greater ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/89A01K67/027
CPCC12N15/8509A01K67/0276A01K2227/40A01K2267/03C07K14/723C12N15/89C12N2800/106C12N2800/60C12N2800/90
Inventor 裴得胜黄波边万平
Owner CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More