Development and applications of heat shock induced Cas9 enzyme transgene danio rerio
A heat shock induction, zebrafish technology, applied in genetic engineering, the use of microinjection, the introduction of foreign genetic material using vectors, etc., can solve problems such as lack of gene editing methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Obtaining the Cas9 enzyme expression vector pTol2-HSP70-Cas9-2A-eGFP
[0041] Utilize BamHI and SalI to cut the plasmid vector pTol2-CMV-eGFP (such as figure 2 shown), enzyme digestion system: 10xGreen Buffer 5ul, plasmid vector pTol2-CMV-eGFP 8.8ul (0.284ug / ul), BamHI 2.5ul, SalI2.5ul, add water to make up 50ul. The 7993bp fragment was recovered by agarose gel electrophoresis to obtain the backbone fragment pTol2.
[0042] The plasmid vector pISceI-HSP70-Cas9-2A-eGFP was digested by BamHI and SalI double enzymes (such as image 3 shown), enzyme digestion system: 10x Green Buffer 5ul, plasmid vector pISceI-HSP70-Cas9-2A-eGFP 7.7ul (0.321ug / ul), BamHI2.5ul, SalI 2.5ul, add water to make up 50ul. After the digestion was completed, the 6969bp fragment was recovered by agarose gel electrophoresis to obtain the insert fragment HSP70-Cas9-2A-eGFP.
[0043] The backbone fragment pTol2 and the insert fragment HSP70-Cas9-2A-eGFP were ligated. The ligation reaction ...
Embodiment 2
[0053] Example 2 Injection of Cas9 enzyme expression vector into zebrafish fertilized eggs
[0054] (1) Obtaining zebrafish fertilized eggs
[0055] Before fertilization, the male and female broodstock were separated and placed in the spawning box at a ratio of 1:1-2 for isolation culture. The egg-laying box was placed in a constant temperature environment of 26°C-29°C for overnight culture in the dark, and the photoperiod was 14h in daylight and 10h in darkness. At the end of the cultivation, the partition board was removed and the inner layer with the fence at the bottom was obliquely placed on the outer layer mating box, and placed in a constant temperature environment to obtain fertilized zebrafish eggs.
[0056] (2) Inject the Cas9 enzyme expression vector into zebrafish fertilized eggs
[0057] Using a microinjector and referring to the microinjection method, the Cas9 enzyme expression vector pTol2-HSP70-Cas9-2A-eGFP constructed in Example 1 (such as figure 1 shown) a...
Embodiment 3
[0063] The knockout of embodiment 3 zebrafish MC4R gene
[0064] (1) Determination of MC4R gene targeting sites and preparation of gRNA
[0065] Design the MC4R gene targeting site, select the appropriate targeting sequence according to the results given by the website (http: / / zifit.partners.org / favicon.ico), the targeting sequence selected by the present invention is shown in SEQ ID NO.1, specifically For: GGGGGTGTTTGTGGTGTGCT.
[0066] The present invention adopts the method of PCR to amplify the transcription template of gRNA. First, design primers according to the selected targeting sequence, the upstream primer sequence is as SEQ ID NO.2, specifically:
[0067] TAATACGACTCACTATAGGGGGTGTTTGTGGTGTGCTGTTTTAGGCTAGAAATAGC; the downstream primer sequence is shown in SEQ ID NO.3, specifically: AGCACCGACTCGGTGCCAC.
[0068]The plasmid containing the gRNA backbone is used as a template, and the backbone sequence is shown in SEQ ID NO.4, specifically: AGCTTGAAATTAATACGACTCACTATA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



