Method for labeling plant seeds with deep red fluorescent protein
A fluorescent protein, deep red technology, applied in the field of plant molecular biology, can solve the problems of limited application and limited commercial application of trans-memory plants, and achieve the effect of good application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Construction of the recombinant expression vector 1300FP635 of deep red fluorescent protein TurboFP635
[0049] 1. Synthesis of deep red fluorescent protein TurboFP635
[0050] When artificially synthesizing the deep red fluorescent protein gene sequence, it has the repeat sequence ctagaggatccacggtacc with the vector 1300GUSplus before the start codon ATG, and has an NcoI restriction site. After the stop codon TGA, it has the repeated sequence atcaacaactctcctggcgcaccatcgtcggctacagcctcgggaattgctaccgagctcgaatttccccgatcgttc with the vector 1300GUSplus, and has a SacI restriction site. Designed for a one-step build-to-vector.
[0051] 2. Design PCR TurboFP635 primers
[0052] Primers were designed using the Gibson Assembly method, and the amplified product was inserted into the NcoI and SacI restriction sites of the 1300GUSplus vector. The primers for amplifying the TurboFP635 gene are shown in the sequences SEQ ID NO:8 and SEQ ID NO:9.
[0053] PCR reaction s...
Embodiment 2
[0072] Cloning of Example 2 Rice Seed-Specific Promoter ZZ1
[0073] 1. Extraction of rice genomic DNA
[0074] Rice genomic DNA was extracted according to the method instructions of the Plant DNA Isolation Kit (Chengdu Fuji Biotechnology Co., Ltd.). The genome was derived from fresh leaves of rice Nipponbare variety. The extracted genomic DNA was aliquoted and stored at -20°C for later use.
[0075] 2. Design PCR primers for amplifying ZZ1
[0076] Primers were designed using the Gibson Assembly method, and the amplified product was inserted into the NcoI restriction site of the 1300FP635 vector. The primers for amplifying the ZZ1 gene are shown in the sequences SEQ ID NO:4 and SEQ ID NO:5. Among them, about 15 nucleotide sequences at the 5' ends of the upstream and downstream primers were repeated with the corresponding connection positions of the vector to facilitate Gibson Assembly connection.
[0077] PCR reaction system (100μ1):
[0078] DNA template: 3μl (50ng)
...
Embodiment 3
[0089] Example 3 Construction of the recombinant expression vector 1300FP635-ZZ1 of the seed-specific promoter ZZ1
[0090] See the build process figure 2 , Insert the amplified product of Example 2 into the NcoI restriction site of the 1300FP635 vector.
[0091] Primers SEQ ID NO: 5 and SEQ ID NO: 5 amplify the PCR product and recover a product of about 2008bp by 1% agarose gel electrophoresis. The vector 1300FP635 was digested with NcoI, and the linearized vector was recovered.
[0092] 2× ligation kit to ligate seed-specific promoter ZZ1 to vector 1300FP635.
[0093] The 10ul system is as follows:
[0094] 2.5 μl ZZ1 PCR product (50ng)
[0095] 2.5μ1 enzyme-cut carrier (100ng)
[0096] 5μ1 Ligation Mix
[0097] Ligation procedure: 50°C for 60 minutes.
[0098]Transformation: Take 2 μl of the above ligation product and transform Escherichia coli competent cells by electroporation. Select positive clones for sequencing. Named 1300FP635-ZZ1. The 1300FP635 vector cont...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More