Preparation method of ursodesoxycholic acid and enzyme for preparation
A technology of ursodeoxycholic acid and cholanoic acid, which is applied in the field of beta-steroid dehydrogenase, can solve the problems of residual organic solvent, long reaction time, complicated operation and the like, and achieves short reaction time, simple operation and high catalytic activity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
preparation example Construction
[0025] The specific implementation process of the preparation method of ursodeoxycholic acid provided by the invention is as follows:
[0026] Suspend 3α-hydroxy-7oxo-5β-cholanic acid in 50-100mM potassium phosphate buffer (pH8.0), adjust the pH to 8.0 with 10M NaOH, and then add the final concentration of 30-50mg / mL Glucose and use 10M NaOH to adjust the pH to 7.8-8.0, add 7β-steroid dehydrogenase and glucose dehydrogenase, and finally add NADP with a final concentration of 0.1-0.25mg / mL, and the final concentration of the substrate is 50-100mg / mL mL, the reaction is carried out at a temperature of 25-35°C, 200-400rpm and a pH of 7.5-8.5, and the reaction time is 8-15h. Take the reaction solution at regular intervals and dilute it 50-100 times with the mobile phase, and inject samples for liquid phase analysis after microporous filtration. For liquid phase detection, use Phenomenx Gemini 5μmNX-C18 110A 250×4.6mm as the analytical column, and the mobile phase is acetonitrile:...
Embodiment 1
[0029] Preparation of co-expression recombinant plasmid pET22b-BH1-GDH containing parental genes
[0030] will be derived from Turneriella parva The 7β-steroid dehydrogenase gene BH1 and derived from Bacillus megaterium ( Bacillus megaterium ) of the glucose dehydrogenase gene GDH by using the primer pair 5'CGCCATATGATGAAAGACCTCAGAAACAAAG3' and 5'CCGGAATTCTTAACCAACCCTTTGCGTCA3' and the primer pair 5'CCGGAATTCAAGGAGATATACATATGAAGATCTTCGCGTACGGTA3' and 5'CCGCTCGAGTTAATATTCCACCGCAATGC3' respectively to obtain the PCR product through PCR amplification technology, and then insert it into Expression vector pET22b(+) Nde I and Eco R I site and Eco R I site and xhoI site, the co-expression recombinant plasmid pET22b-BH1-GDH was obtained. Through DNA sequencing, it is determined that the nucleotide sequence of the cloned parent 7β-steroid dehydrogenase is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2; it is determined that the cloned parent gluc...
Embodiment 2
[0032] Preparation of co-expression recombinant plasmids containing 7β-steroid dehydrogenase mutants
[0033] Perform site-directed mutation on the 7β-steroid dehydrogenase parent by reverse PCR technology, design reverse primers at the mutation position, use upstream and downstream mutation primers to amplify the target fragment, and introduce corresponding mutations on the primers to recombine plasmid pET22b-BH1 -GDH was used as a template for inverse PCR, and the PCR product was Dpn I enzyme digested the template and transformed it into Escherichia coli Rosetta (de3). After screening by Amp, colonies were picked and sent for sequencing. The mutation sites and primer design are shown in Table 1.
[0034] The PCR system is: TaKaRa EX Taq HS 0.25ul; 10×Ex Taq Buffer 5ul; template plasmid 1ul; dNTP (2.5mM each) 4ul; upstream primer 1ul; downstream primer 1ul; sterile water up to 50ul.
[0035] The PCR program is: first 98°C for 2min; then 98°C for 10s, 50-65°C for 30s, 72°C...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More