Method for increasing grain number per ear and reducing plant height by use of rice SNB genes

A technology of grain number per ear and rice is applied in the application field of rice SNB gene in increasing grain number per ear and reducing plant height, which can solve the problems that cannot be directly used for rice breeding, and the number of branches and spikelets is reduced, so as to increase the number of grains per ear in rice. Count, the effect of reducing plant height

Inactive Publication Date: 2017-05-24
HUAZHONG AGRI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In rice, two AP2-like genes (SNB and OsIDS1) regulated by microRNA172 have been reported to be involved in the development of floral organs. In their double mutants, the number of panicle branches and spikelets will be severely reduced, so the Genetic materials such as mutants cannot be directly used for rice breeding (Lee and An, Two AP2family genes, SUPERNUMERARY BRACT (SNB) and OsINDETERMINATE SPIKELET 1 (OsIDS1), synergistically control inflorescence architecture and floralmeristem establishment in rice. Plant J, 2012, 69: 445-461)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing grain number per ear and reducing plant height by use of rice SNB genes
  • Method for increasing grain number per ear and reducing plant height by use of rice SNB genes
  • Method for increasing grain number per ear and reducing plant height by use of rice SNB genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1: the cloning of rice SNB gene

[0046] The present invention adopts the cDNA obtained by reverse transcription of the RNA of rice leaves as a template, and utilizes the specific primers of the SNB gene (LOC_Os07g13170, whose nucleotide sequence is shown in SEQ ID NO: 1), to isolate and clone the SNB gene by PCR. For the protein coding region, the specific operations are as follows:

[0047] (1) Extract RNA from rice leaves

[0048] Extract the RNA of rice variety Zhonghua 11 (Institute of Crop Science, Chinese Academy of Agricultural Sciences) plant tillering stage leaves, the reagents used for RNA extraction are purchased using the Trizol extraction kit produced by Invitrogen Company (the specific operation steps are provided according to the instructions provided by the kit) operate).

[0049] (2) Reverse transcription to synthesize the first strand of cDNA

[0050] The steps are as follows: 1) Take 2 μg of extracted total RNA, add 1 μl of DNaseI, 1 μl...

Embodiment 2

[0057] Example 2: Mutation of microRNA172 binding site in SNB

[0058] Because SNB is regulated by microRNA172 (such as figure 1 shown), therefore in order to overexpress SNB, the present invention uses overlap extension PCR to mutate the binding site of microRNA172 in the SNB gene (overlap extension PCR method with reference to Sam Brook, "Molecular Cloning Experiment Guide" third edition, Science Press, 2002; the basic process is as follows figure 2shown). The sequence of the binding site of microRNA172 in SNB is TGCAGCATCATCAGGATTCT, the present invention mutates the binding site to CGCCGCCAGCAGCGGCTTTT, and the mutated SNB gene is named rSNB gene. The rSNB gene will no longer be regulated by microRNA172, but the mutation is synonymous and therefore does not change the sequence of the protein encoded by SNB.

[0059] To achieve the above goals, the following primers were designed:

[0060] MSNBF (forward primer): 5'-CCTAC CGCCGCCAGCAGCAGCGGCTTTT CTACGGGCACCGTCGCC-3' ...

Embodiment 3

[0063] Example 3: construction of an overexpression vector for the protein coding region of the rSNB gene with mutations in the microRNA172 recognition site

[0064] Double-digest plasmid TA-rSNB with BamHI and XbaI (the BamHI and XbaI were purchased from Bao Biological Engineering Dalian Co., Ltd., and the specific usage and dosage refer to the instructions of the corresponding products of the company. The plasmid TA-rSNB comes from Example 2, as shown in image 3 Shown in A figure in the middle), reclaim the DNA fragment of 1323bp that comprises rSNB, then with the vector plasmid pCAMBIA1301S [this vector is publicly reported through BamHI and XbaI double digestion: Zhou et al., Over-expression of aspartate aminotransferase genes in rice resulted in altered nitrogen metabolism and increased amino acid content in seeds. Theor Appl Genet, 2009, 118:1381-1390; its basic skeleton originated from CAMBIA laboratory in Australia (http: / / www.cambia.org / daisy / cambia / materials / overvi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of plant gene engineering, in particular to a method for increasing the grain number per ear and reducing plant height by use of rice SNB genes. The nucleotide sequence of SNB genes is shown as SEQ ID NO:1. Artificially mutant rSNB genes are obtained by changing the binding site of microRNA172 in the SNB genes, the nucleotide sequence of the rSNB genes is shown as SEQ ID NO:2, and the sequence of protein encoded by the rSNB genes is shown as SEQ ID NO:3. The grain number per ear of rice is remarkably increased and the plant height of the rice is notably reduced through overexpression of rSNB, and further studies prove that SNB encoded protein has the activity of a transcription suppressor. The functions of the SNB genes on increasing the grain number per ear of the rice and reducing the plant height of the rice are disclosed, and a novel rice genetic improvement method is also provided.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering. It specifically relates to the application of the rice SNB gene in increasing the number of grains per panicle and reducing the height of the plant. Through transgenic method, overexpressing the protein coding region of rSNB gene with microRNA172 binding site mutation in rice significantly increased the number of grains per panicle and decreased plant height, indicating that SNB gene has important utilization value in rice genetic improvement. Background technique [0002] With the continuous growth of the global population and changes in human consumption patterns, the global food crisis is becoming increasingly severe. Rice is one of the most important food crops in the world. More than half of the population in my country takes rice as the staple food. Therefore, increasing rice production is of great strategic significance to ensure national food security. [0003] The yie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/10C12N15/82A01H5/00
Inventor张启发王磊
OwnerHUAZHONG AGRI UNIV