Recombinant strain capable of producing tyrosol and construction method thereof

A technology for producing cheese and recombining vectors, applied in the field of microorganisms, can solve the problems of expensive raw material phenylethanol, restricting large-scale industrial production, low yield and the like

Active Publication Date: 2017-05-31
JIANGNAN UNIV
View PDF1 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This process has high yield, but its disadvantage is that the price of raw material phenylethanol is expensive and the supply is tight
Other chemical synthesis processes, such as p-nitrotoluene synthesis method, have relatively low raw material prices, more sources of goods, and lower costs, but the steps are longer and the yield is low, which is not conducive to environmental protection; the yield of p-hydroxystyrene synthesis method is 96%. , with a purity of 99%, high yield and purity, and has certain value, but the large input of raw material costs also restricts large-scale industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant strain capable of producing tyrosol and construction method thereof
  • Recombinant strain capable of producing tyrosol and construction method thereof
  • Recombinant strain capable of producing tyrosol and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] 1. Construction of the recombinant plasmid pRSFDuet-ARO10 containing the gene encoding pyruvate decarboxylase

[0029] According to the reported nucleotide sequence of the coding gene ARO10 of Saccharomyces cerevisiae pyruvate decarboxylase (the GenBank number of the ARO10 gene sequence is 851987), the following primers were designed, and an NcoI restriction site (marked with an underline) was introduced into the upstream primer, A BamHI restriction site (underlined) was introduced into the downstream primer.

[0030] aro101: CATG CCATGG GCATGTCTGAAATTACTTTGGGT

[0031] aro102: GGCGCCGC GGATCC TATTTTTTATTTCTTTTA

[0032] The genomic DNA of Saccharomyces cerevisiae Eby100 was used as a template, and aro101 and aro102 were used as primers for PCR amplification. The obtained PCR product was subjected to 1% agarose gel electrophoresis, and the electrophoresis results were as follows: figure 2 As shown, a specific band of about 1908bp was obtained, and its size was c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a recombinant strain capable of producing tyrosol and a construction method thereof, and belongs to the field of microorganisms. The method comprises the following steps: constructing a recombinant carrier pRSFDuet-ARO10-ARO8 by a gene engineering technology; transforming the recombinant carrier into escherichia coli BL21(DE3) from which a gene pheA and a gene feaB are removed by gene engineering to obtain a strain BE0; carrying out a whole-cell catalysis reaction; fermenting for 20 hours by taking 10mN of tyrosine as a substrate to produce 6.76mM of tyrosol, wherein the tyrosine transformation ratio can be up to 67.3 percent; performing chemical mutagenesis on the basis of the recombinant strain to obtain a recombinant strain BE2 capable of producing tyrosol at high yield with optimized performance; carrying out a whole-cell catalysis reaction; fermenting for 20 hours by taking 10mN of tyrosine as a substrate to produce 8.71mM of tyrosol, wherein the tyrosine transformation ratio can be up to 87.1 percent.

Description

technical field [0001] The invention relates to a recombinant bacterial strain producing tyrosol and a construction method thereof, belonging to the field of microorganisms. Background technique [0002] Tyrosol (4-(2-Hydroxyethyl)phenol) is a natural antioxidant derived from olive oil and a derivative of phenylethyl alcohol. As an antioxidant, it protects cells from oxidative damage. For phenolic compounds, it has great industrial value. Tyrosol, and its derivatives, are synthons for the synthesis of various organic compounds. For example, tyrosol can be used to prepare commercially available pharmaceutical agents, such as, betaxolol and metoprolol, these agents are selective β1 receptor blockers, and can be used to treat hypertension, Angina, heart failure, and glaucoma. In addition, tyrosol may be the precursor of hydroxytyrosol. Hydroxytyrosol (2-(3,4-dihydroxyphenyl)ethanol) is an antioxidant beneficial to human health. Compared with tyrosol, its antioxidant Strong...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12P7/22C12P7/18C12R1/19
CPCC12N9/1096C12N9/88C12P7/18C12P7/22C12Y401/01001
Inventor 陈献忠薛宇翔杨翠樊游沈微
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products