Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor

A technology of pluripotent stem cells and transcription factors, applied in artificially induced pluripotent cells, biochemical equipment and methods, animal cells, etc., can solve the problems of low-efficiency iPSCs, restrict the development and application of ESCs technology, and improve the induction efficiency. Effect

Active Publication Date: 2017-05-31
INNER MONGOLIA SAIKEXING LIVESTOCK BREEDING & SEED IND BIOTECH RES INST CO LTD +1
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, issues such as ethics, law and immune rejection have always restricted the further development and application of ESCs technology.
[0004] However, people's research on iPSCs technology is still in its infancy, and its low efficiency is one of the main obstacles to the application of iPSCs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor
  • Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor
  • Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: the preparation of carrier

[0050] The mouse Oct4Tale R-dTF vector (Reprogramming to pluripotency usingdesigner TALE transcription factors targeting enhancers (Gao et al., 2013)) was used to engineer Tale R-dTF (R6) that specifically recognizes and binds to the first intron region of Xist, The final R6 is an expression vector driven by the Doxycycline (Dox)-dependent promoter TRE carried by the PB vector (for the structure and binding site of the Xist Tale inhibitory effector R6, see figure 2 and image 3 ). The specifically identified DNA sequence is TTAAGTGTTATGGACAAGGA (reference gene sequence number in GeneBank: NC_000086.7)

Embodiment 2

[0051] Example 2: Preparation of feeder cells

[0052] Take the MEFs that have grown to 80% confluence within 3-5 passages, discard the original culture solution, add 6 mL of the MEF culture solution with a final concentration of 10 mg / L mitomycin C, and treat the cells in a 100 mm cell culture dish for 2.5 hours; discard Add 5 mL of D-PBS to the culture medium to wash the cells, repeat 3 times, completely remove mitomycin C, add 2 mL of 0.5 g / L trypsin-0.02% EDTA digestion solution, incubate and digest at 37 °C for 1 min, and place under an inverted phase-contrast microscope After observing that the cells shrink and become round, gently pat the side wall of the culture dish with your hands, and the cell layers will come off from the bottom of the dish. At this time, add an equal amount of M10 culture medium to stop digestion; Perform pipetting and mixing, collect the cell suspension into a 15mL centrifuge tube for cell counting, then centrifuge at 1000r / min for 3min, discard ...

Embodiment 3

[0053] Embodiment 3: Establishment of Oct4-GFP MEFs

[0054] Sexually mature C57BL / 6J female mice and MF1, 129 / sv male mice carrying Oct4-GFP were caged at a ratio of 1(♂):2(♀), and the pregnant mice at 13.5 days old were cesareaned to obtain fetuses, and washed Finally, remove the head, limbs and tail, wash and cut into pieces, digest with 0.5g / L trypsin-0.02% EDTA digestion solution in a 37°C water bath for 20min, and mix several times during the period; continue to add 0.5g / L trypsin Protease-0.02% EDTA digestion solution, digested in a water bath at 37°C for 20min. After mixing by pipetting, culture medium was added to stop the digestion, and centrifuged at 1000rpm for 10min. Discard the supernatant, add an appropriate amount of culture medium, pipette about 10 times repeatedly, place in a T25 culture bottle at 37°C, 5% CO 2 Culture in the incubator (Oct4-GFP MEFs growth status see Figure 4 ), after reaching 80% confluence, subculture and culture at 1:3-1:5, and other ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for preparing induced pluripotent stem cells by using a Xist Tale inhibitory transcription factor. Synergism of the transcriptional activator-like effectors (Tale)-based inhibitory transcription factor combined to a first intron region of Xist, Oct4, Sox2, Klf4 and c-Myc enhances the efficiency of induction of mouse fibroblasts to the induced pluripotent stem cells. Obtained iPSCs have typical pluripotent stem cell characteristics including involvement in the development of chimeric mice. The method actively promotes the clinical application and researches of the iPSCs, and provides new technical and theoretical bases for studying how to obtain and improve the iPSCs in people, pigs, cattle and other mammals.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor combined with Oct4, Sox2, Klf4 and c-Myc. Background technique [0002] Embryonic stem cells (ESCs) are a type of highly undifferentiated cells with developmental totipotency. Under appropriate conditions, it can proliferate indefinitely, and can differentiate into all cells of adult animal tissues and organs, such as hematopoietic cells, nerve cells, cardiomyocytes, etc. It has application value in many fields such as animal cloning, transgenic animal production, disease treatment, tissue engineering, regenerative medicine, disease mechanism and treatment research, drug discovery and evaluation, etc. However, issues such as ethics, law and immune rejection have always restricted the further development and application of ESCs technology. [0003] In 2006, Japanese scienti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10
CPCC12N5/0696C12N2501/60C12N2501/602C12N2501/603C12N2501/604C12N2506/13
Inventor张金吨李喜和刘澎涛梁延峰范丽红韩红梅
OwnerINNER MONGOLIA SAIKEXING LIVESTOCK BREEDING & SEED IND BIOTECH RES INST CO LTD