A kind of mutant tn5 transposase and its preparation method and application

A transposase and mutant technology, applied in the field of mutant Tn5 transposase and its preparation, can solve the problems of deletion, problem of result coverage, uneven results, etc., achieve good coverage, save sequencing and analysis costs , the effect of controllable response

Active Publication Date: 2019-05-14
VAZYME BIOTECH NANJING
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although the transposition insertion activity and affinity to DNA of the mutant Tn5 transposase used in the mainstream have been effectively enhanced, there is still a preference for the target DNA sequence on the basis of the improvement of the activity and stability of the enzyme. Sexuality is a shortcoming of transposases used in library construction. The preference of adding adapters in the process of library construction will lead to inhomogeneity and missing results, resulting in problems with the coverage of the results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of mutant tn5 transposase and its preparation method and application
  • A kind of mutant tn5 transposase and its preparation method and application
  • A kind of mutant tn5 transposase and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1 The preparation method of the Tn5 transposase whose amino acid sequence is shown in SEQ ID NO.2 comprises the following steps:

[0057] 1) Construct the vector containing the nucleotide sequence encoding the mutant Tn5 transposase

[0058] Using the method of gene synthesis, the primer sequences containing the sites to be mutated and the substituted bases were synthesized as follows:

[0059] A97-f: gccattgaggaaaccacct;

[0060] A97-r: aggtggtttcctcaatggc;

[0061] B188-f: gcggtctgtgaacgcgaagc;

[0062] B188-r: gcttcgcgttcacagaccgc;

[0063] C326-f: cggatcgacgagttccata;

[0064] C326-r: tatggaactcgtcgatccg;

[0065] Utilize PCR to amplify the EK / LP Tn5 transposase gene (its gene sequence shown in SEQ ID NO.1) of transformation, respectively with primer A97-f and B188-r, B188-f and C326-r, C326 -f and A97-r were used as primers. In a 50 μl reaction system, the plasmid containing the EK / LP Tn5 transposase gene was used as a template, 2 μl of 10 μM prime...

Embodiment 2

[0068] Example 2 Transforming the host cell with the vector to obtain a recombinant cell:

[0069] Take 10 ng of the vector verified by sequencing and transform it into BL21 competent cells by the same transformation method, spread it on the LB plate containing ampicillin, and culture overnight at 37°C. Single clones were picked the next day.

Embodiment 3

[0070] Example 3 Cultivate and collect recombinant cells, extract and purify mutant Tn5 enzyme

[0071] Specific steps are as follows:

[0072] Pick the monoclonal recombinant cells into 3ml LB liquid medium, shake and cultivate for 6-8h, then transfer and expand into 300ml LB liquid medium, shake for 4-6h, add IPTG to the final concentration of 50mmol / L Continue to shake overnight to induce the expression of the target protein. Dispense 300ml of bacterial liquid into 50ml centrifuge tubes, and collect bacterial cells by centrifugation at 5000rpm for 10min. Add 10ml of elution buffer (50mmol / L Tris-HCl pH7.9; 50mmol / L dextrose; 1mmol / LEDTA) to resuspend each 100ml of bacterial liquid after centrifugation, place on ice for 1h; centrifuge at 3500rpm for 3min to re-collect the bacteria. Add 50ml pre-lysis buffer (elution buffer plus 4g / L lysozyme), let stand at room temperature for 15min; add 50ml lysis buffer (10mmol / L Tris-HCl pH7.9; 50mmol / L KCl; 1mmol / L EDTA; 1mmol / L PMSF...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed are a mutant type Tn5 transposase and a preparation method and application thereof. The mutant type Tn5 transposase has the advantages that an existing EK / LP Tn5 transposase is subjected to site-directed mutagenesis for lowing DNA preference, site-directed mutagenesis refers to mutagenesis in at least two of D97E, D188E and E326D and improves a protein sequence and a conformation of the Tn5 transposase, and a reaction system is subjected to fine adjustment, so that preference of the Tn5 transposase to DNA target sequence insertion is improved, DNA library construction uniformity is improved remarkably, library construction results have better coverage degree, and requirements of high-throughput sequencing library construction are met.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a mutant Tn5 transposase and its preparation method and application. Background technique [0002] Transposases are a large class of proteins of bacterial origin that perform "cut-paste" or "copy-paste" DNA insertion by binding to the ends of transposon sequences and catalyzing their movement to random locations on the genome. There are many kinds of transposases, and the first to be discovered is the Tn3 transposon, which can make maize change color randomly. Natural transposons have very low activity in organisms and play an important role in randomly changing genetic material and promoting evolution during evolution. The important property that transposase can introduce random mutations in the genome has also been applied to the library construction process in the recently developed next-generation sequencing technology, which can randomly add known sequence adapters ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/10C12N15/70C40B50/06C12Q1/6806
CPCC12N9/1241C12N15/1031C12N15/70C12Q1/6806C40B50/06C12Q2531/113C12Q2525/191
Inventor曹林张力军聂俊伟齐心韩锦雄瞿志鹏徐晓昱
OwnerVAZYME BIOTECH NANJING