A gene encoding chloroplast carbonic anhydrase was used in the construction of high-concentration co 2 and applications in fast-growing industrial engineered microalgae

A technology of carbonic anhydrase and chloroplast, which is applied in the application field of industrial engineering microalgae, can solve the problems such as the lack of understanding of the CCM network regulation mechanism of Nannochloropsis and the lack of genetic transformation, so as to increase the growth rate, reduce production costs, and reduce pollution. Effect

Active Publication Date: 2020-08-14
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current understanding and genetic modification of the CCM network regulation mechanism of Nannochloropsis are very scarce.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene encoding chloroplast carbonic anhydrase was used in the construction of high-concentration co  <sub>2</sub> and applications in fast-growing industrial engineered microalgae
  • A gene encoding chloroplast carbonic anhydrase was used in the construction of high-concentration co  <sub>2</sub> and applications in fast-growing industrial engineered microalgae
  • A gene encoding chloroplast carbonic anhydrase was used in the construction of high-concentration co  <sub>2</sub> and applications in fast-growing industrial engineered microalgae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Obtaining of the complete sequence of Nannochloropsis oceanica IMET1 carbonic anhydrase

[0033] By sequencing the whole genome of Nannochloropsis, the complete sequence of chloroplast carbonic anhydrase encoded by the nuclear genome was preliminarily obtained, as shown in SEQ ID No.1 and SEQ ID No.2; and the homologous sequence of SEQ ID No.2 SEQ ID No. 3.

[0034] The complete reading frame (ORF) of chloroplast carbonic anhydrase was further verified by polymerase chain reaction PCR. The PCR primer sequence was: F1 was 5'ATGTGGCGGCGTGTGCTCGCA3'; R1 was 5'CTAGACGCTTTTATTAACC3'. The PCR reaction system includes 5XPCR reaction buffer (5X DNA buffer) 5ul, deoxyribonucleoside triphosphate (dNTP) 4ul, magnesium sulfate (MgSO 4 ) 2ul, forward primer (Forward primer) 2ul, reverse primer (Reverse primer) 2ul, DNA 3ul, DNA polymerase (KOD DNA poleymase) 0.5ul, ddH 2 O is 32.5ul, and the total reaction system is 50ul;

[0035] The PCR reaction program was the first ...

Embodiment 2

[0037] 1) Construction of RNAi expression vector

[0038] The construction of the RNAi expression vector uses phir-PtGUS as the carrier backbone. First, the Nannochloropsis genome is used as a template by PCR amplification reaction to amplify a 229bp fragment (CA2 gene sequence 1395bp to 1623bp position) and a 404bp fragment (CA2 gene sequence 1395bp to 1798bp position) two PCR fragments;

[0039] Wherein, the primers for amplifying the 229bp fragment are:

[0040] CA2_Fw (5'CGGAATTCGGGCATAGAGTGCGAATTGA3'; contains EcoRI site) / CA2_Rv1 (5'GCTCTAGACGCTTTTATTAACCCCATCC3'; contains XbaI site);

[0041] The primers for amplifying the 404bp fragment are:

[0042] CA2_Fw (5'CGGAATTCGGGCATAGAGTGCGAATTGA3'; contains an EcoRI site) / CA2_Rv2 (5'GCTCTAGAATCCTGGTCGTCAAAGAACG3'; contains an XbaI site).

[0043] The above reaction systems for PCR amplification are all 50ul: including 5XPCR reaction buffer (5X DNA buffer) 5ul, deoxyribonucleoside triphosphate (dNTP) 4ul, magnesium sulfate (...

Embodiment 3

[0052] The PCR verification of embodiment 3 transformants

[0053] Pick the transformant with a toothpick and put it in fresh f / 2 medium (containing 3-5ug / ml Zeocin antibiotic), culture it in a light incubator, wait for it to grow for 2-3 weeks, collect the algae cells by centrifugation, and use genomic DNA extraction reagent The genomic DNA of the transformant was extracted using the OMEGA HP DNAextration kit, and the genomic DNA of the wild-type Nannochloropsis was also extracted as a control for subsequent experiments. After the genome was extracted and quantified by Nannodrop, PCR amplification was performed with forward primer F1 (5'TTATCAACGGCATACCGGCACTG3') and reverse primer R1 (5'CTGATGAACAGGGTCACGTCGT3'), the reaction system was 50ul: 5XPCR reaction buffer (5X DNA buffer) 5ul , deoxyribonucleoside triphosphate (dNTP) 4ul, magnesium sulfate (MgSO 4) 2ul, forward primer (primer F1) 2ul, reverse primer (primer R1) 2ul, template DNA (DNA) 3ul, DNA polymerase (KOD plus D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of microorganism gene engineering, and particularly relates to and discloses application of coded chloroplast carbonic anhydrase genes in establishing industrial engineering microalgae capable of resisting high-concentration CO2 and growing quickly. A method disclosed by the invention provides a basis and a practicable method for the industrial microalgae in fixing industrial CO2 waste gas.

Description

technical field [0001] The invention belongs to the technical field of microbial genetic engineering, and specifically relates to the disclosure of a gene encoding chloroplast carbonic anhydrase in the construction of high-concentration CO 2 and fast-growing industrial engineered microalgae. Background technique [0002] With the increasing shortage of global fossil energy and the global warming caused by the development of modern industry and agriculture, the development of clean and renewable new energy has become an inevitable trend, and microalgae bioenergy is the savior with high hopes. According to statistics, CO in the air in nature 2 40% of the total carbon fixation is done by photosynthetic organisms such as marine microalgae. This is due to the fact that microalgae are widely distributed in marine ecosystems, have higher carbon fixation rates than land plants, and possess faster growth rates (generation time of microalgae is 4-16 hours). At the same time, since ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/79C12N1/21
CPCC12N9/88C12Y402/01001
Inventor魏力王勤涛辛一徐健
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI