Respiratory tract micro-fluidic chip rapid detection technology and kit

A technology of microfluidic chips and kits, which is applied to the measurement/testing of microorganisms, microorganisms, methods based on microorganisms, etc., and can solve the problems of high price, high price of fluorescent quantitative PCR instrument, and long time period

Pending Publication Date: 2017-09-01
BEIJING BAIKANGXIN BIOLOGICAL SCI & TECH
View PDF6 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The probes and microspheres in this scheme are all expensive raw materials, and the price of the fluorescent quantitative PCR instrument is relatively high, which requires trained professionals to operate, and some hospitals do not have relevant instruments
In addition, in the PCR process of this method, more heating and cooling processes are designed, which makes the entire experiment time period longer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Respiratory tract micro-fluidic chip rapid detection technology and kit
  • Respiratory tract micro-fluidic chip rapid detection technology and kit
  • Respiratory tract micro-fluidic chip rapid detection technology and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0109] 1 Primer preparation

[0110] Methicillin-resistant Staphylococcus aureus, Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, and Stenotrophomonas maltophilia were screened out through a large number of experiments. Nucleic acid amplification primers were designed and synthesized for the nucleic acid fragments of sex genes to obtain the following primers:

[0111] MRSA

[0112] serial number 1

[0113] Forward outer primer F3 TTATGTATCAGGTACTTAT

[0114] serial number 2

[0115] Reverse Outer Primer B3 TTTTGTTATTTTAACCCAATCATTTA

[0116] serial number 3

[0117] Forward internal primer FIP

[0118] ATTCTTCGTTACTCATTACATACATGTGAATTATTATAACTTGTAATAAC

[0119] serial number 4

[0120] reverse inner primer BIP

[0121] AACCGAAGATAAAAAAAGAACCTCTGAATATTTTTTGAGTTGAACCTGGTG

[0122] serial number 5

[0123] Forward loop primer LF AATGGATAGACGTCATATGAAGGT

[0124] serial number 6

[0125] Reverse Loop Pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention is based on a micro-fluidic chip technology and performs rapid detection on seven respiratory tract pathogenic bacteria in combination with a nucleic acid isothermal amplification technology, and belongs to the field of safe and rapid detection of respiratory tract pathogenic bacteria. According to the technology, a sample subjected to rapid treatment is mixed with a reagent in a kit. The mixed liquid is added into a micro-fluidic chip. A primer pre-loaded into the micro-fluidic chip is subjected to a nucleic acid isothermal amplification reaction with a possible microbial gene template in the mixed liquid at certain single temperature. A fluorescent dye in the reaction system is combined with an amplification product to generate a fluorescent signal. Whether the seven pathogens exist in the respiratory tract or not is determined through instrument reading. According to the method, the need for the sample quantity is reduced through the micro-fluidic chip technology, the detection throughput is increased, and seven pathogenic bacteria can be detected at the same time. By adopting the nucleic acid isothermal amplification technology, the detection specificity and sensitivity are improved; the operation is simple, and the reaction time is short. A simple and rapid respiratory tract pathogenic bacteria detection technology is provided for clinical use.

Description

technical field [0001] The technology belongs to the field of rapid detection of respiratory pathogenic bacteria. It involves a microfluidic chip rapid detection technology and nucleic acid isothermal amplification technology; specifically, it relates to a respiratory microfluidic chip rapid detection technology and a kit, specifically including methicillin-resistant Staphylococcus aureus, Staphylococcus aureus, large intestine Escherichia, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia specific gene conservation sequence has specific primers and primer sets; also relates to the use of primers and primer sets Detection of Methicillin-resistant Staphylococcus aureus, Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia by isothermal amplification method detection methods and detection kits. Background technique [0002] Lower respira...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/14C12Q1/10C12Q1/04C12R1/445C12R1/19C12R1/22C12R1/385C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2565/629
Inventor 屈彬彬苏海峰高亚平吴国君
Owner BEIJING BAIKANGXIN BIOLOGICAL SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products