PL-LbCpf1-RR gene with high mutagenic efficiency in gene targeting, and application thereof
A gene targeting, pl-lbcpf1-rr technology, applied in the fields of biotechnology and plant genetic engineering, can solve problems such as a small number, no established theory or method, and a limited number of LbCpf1 editables.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1——The acquisition of PL-LbCpf1-RR gene
[0036] The inventors of the present application tried to transform the LbCpf1-RR gene from Escherichia coli in various ways, accidentally obtained a new DNA sequence, and added a rice-preferred stop codon TGA to the end of the DNA sequence to form A new gene, the gene is named as PL-LbCpf1-RR, the sequence is shown in SEQ ID NO: 1, see the sequence comparison with LbCpf1-RR figure 1 .
[0037] Further analysis of its base composition, the results are shown in Table 2. It is known from Table 2 that the GC content of PL-LbCpf1 is as high as 53.06%, significantly higher than that of LbCpf1 which is 50.09%. In this way, the gene structure is more stable, because 3 hydrogen bonds can be formed between GC and 2 between AT.
[0038] Table 2 Gene base composition analysis of PL-LbCpf1-RR and LbCpf1-RR.
[0039]
[0040] Analysis-RR LbCpf1-RR and LbCpf1-RR protein amino acid sequence encoded by the gene, comparison res...
Embodiment 2
[0042] Example 2 - Construction of Plant Targeting Vector Containing PL-LbCpf1-RR Gene
[0043] From the Escherichia coli XL-blue containing the PUC57-AMP-PL-LbCpf1-RR vector, the plasmid was extracted with the Axygen plasmid extraction kit, digested with NotI / SacI, and the PL-LbCpf1-RR fragment was recovered. At the same time, NotI / SacI enzyme was used to linearize pHUN600, and pHUN600 was recovered, and the above-mentioned PL-LbCpf1-RR fragment and pHUN600 fragment were connected with T4 ligase (purchased from TaKaRa Company) to obtain the plant expression vector pHUN600-PL-LbCpf1 -RR( image 3 ), named pHUN 6a11.
[0044] The nucleotide sequence TTCAGGTTTGATAGAAAACTGAAGAACACATAT at positions 3647-3675 in the rice PDS gene (LOC_Os03g0184000) was selected as the targeting site. The target site sequence was fused to pHUN6a11 to form pHUN6a11-PDS. The plant expression vector was transformed into Agrobacterium tumefaciens EHA105 strain (preserved by Rice Research Institute, A...
Embodiment 3
[0045] Example 3—the genetic transformation of rice using pHUN6a11-PDS as a targeting vector and the acquisition of mutants.
[0046] 1. Induction and pre-culture of mature embryo callus
[0047] The mature seeds of Nipponbare (the Paddy Rice Research Institute of Anhui Academy of Agricultural Sciences are preserved) are shelled, and the seeds with normal appearance and cleanness without mildew are selected, shaken for 90 sec with 70% alcohol, and pour off the alcohol; then use 50% sodium hypochlorite ( The concentration of available chlorine in the stock solution is greater than 4%. Add 1 drop of Tween20) solution per 100 milliliters to clean the seeds, and shake for 45 minutes (180 r / min) on a shaker. Pour off the sodium hypochlorite, wash with sterile water 5-10 times until there is no smell of sodium hypochlorite, finally add sterile water, soak overnight at 30°C. Use a scalpel to separate the embryos along the aleurone layer, put the scutellum up on the induction medium ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


