PL-LbCpf1-RR gene with high mutagenic efficiency in gene targeting, and application thereof

A gene targeting, pl-lbcpf1-rr technology, applied in the fields of biotechnology and plant genetic engineering, can solve problems such as a small number, no established theory or method, and a limited number of LbCpf1 editables.

Inactive Publication Date: 2017-09-08
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the NGG PAM recognized by Cas9, the number of TTTV in the genome is significantly less, resulting in a limited number of editable LbCpf1
[0004] However, there is no general and feasible method to increase the number of LbCpf1 editable sites and improve the mutation efficiency of LbCpf1 gene in crop gene targeting, and the number of existing LbCpf1 genes with high mutation efficiency is limited
Therefore, it is urgently desired to provide more LbCpf1 genes that provide more editing sites in crop gene targeting, but such genes are often unavailable, and there is no established theory or method for people to find them. Such genes provide theoretical basis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PL-LbCpf1-RR gene with high mutagenic efficiency in gene targeting, and application thereof
  • PL-LbCpf1-RR gene with high mutagenic efficiency in gene targeting, and application thereof
  • PL-LbCpf1-RR gene with high mutagenic efficiency in gene targeting, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1——The acquisition of PL-LbCpf1-RR gene

[0036] The inventors of the present application tried to transform the LbCpf1-RR gene from Escherichia coli in various ways, accidentally obtained a new DNA sequence, and added a rice-preferred stop codon TGA to the end of the DNA sequence to form A new gene, the gene is named as PL-LbCpf1-RR, the sequence is shown in SEQ ID NO: 1, see the sequence comparison with LbCpf1-RR figure 1 .

[0037] Further analysis of its base composition, the results are shown in Table 2. It is known from Table 2 that the GC content of PL-LbCpf1 is as high as 53.06%, significantly higher than that of LbCpf1 which is 50.09%. In this way, the gene structure is more stable, because 3 hydrogen bonds can be formed between GC and 2 between AT.

[0038] Table 2 Gene base composition analysis of PL-LbCpf1-RR and LbCpf1-RR.

[0039]

[0040] Analysis-RR LbCpf1-RR and LbCpf1-RR protein amino acid sequence encoded by the gene, comparison res...

Embodiment 2

[0042] Example 2 - Construction of Plant Targeting Vector Containing PL-LbCpf1-RR Gene

[0043] From the Escherichia coli XL-blue containing the PUC57-AMP-PL-LbCpf1-RR vector, the plasmid was extracted with the Axygen plasmid extraction kit, digested with NotI / SacI, and the PL-LbCpf1-RR fragment was recovered. At the same time, NotI / SacI enzyme was used to linearize pHUN600, and pHUN600 was recovered, and the above-mentioned PL-LbCpf1-RR fragment and pHUN600 fragment were connected with T4 ligase (purchased from TaKaRa Company) to obtain the plant expression vector pHUN600-PL-LbCpf1 -RR( image 3 ), named pHUN 6a11.

[0044] The nucleotide sequence TTCAGGTTTGATAGAAAACTGAAGAACACATAT at positions 3647-3675 in the rice PDS gene (LOC_Os03g0184000) was selected as the targeting site. The target site sequence was fused to pHUN6a11 to form pHUN6a11-PDS. The plant expression vector was transformed into Agrobacterium tumefaciens EHA105 strain (preserved by Rice Research Institute, A...

Embodiment 3

[0045] Example 3—the genetic transformation of rice using pHUN6a11-PDS as a targeting vector and the acquisition of mutants.

[0046] 1. Induction and pre-culture of mature embryo callus

[0047] The mature seeds of Nipponbare (the Paddy Rice Research Institute of Anhui Academy of Agricultural Sciences are preserved) are shelled, and the seeds with normal appearance and cleanness without mildew are selected, shaken for 90 sec with 70% alcohol, and pour off the alcohol; then use 50% sodium hypochlorite ( The concentration of available chlorine in the stock solution is greater than 4%. Add 1 drop of Tween20) solution per 100 milliliters to clean the seeds, and shake for 45 minutes (180 r / min) on a shaker. Pour off the sodium hypochlorite, wash with sterile water 5-10 times until there is no smell of sodium hypochlorite, finally add sterile water, soak overnight at 30°C. Use a scalpel to separate the embryos along the aleurone layer, put the scutellum up on the induction medium ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a PL-LbCpf1-RR gene with high mutagenic efficiency in gene targeting, and application thereof. A new PL-LbCpf1-RR gene is unexpectedly obtained in the rice gene targeting experiment process, and the PL-LbCpf1-RR gene can identify more genome sites and has high mutagenic efficiency when being used for performing rice shearing. In addition, the invention provides an expression box and an expression vector, as well as application of the expression box and the expression vector to a rice gene edition aspect. The obtained PL-LbCpf1-RR is used for constructing a plant expression vector and constructing a rice targeting vector, DNA double-chain shear of a rice specific gene site is caused after rice cells are imported, rice gene targeting is realized and high mutagenic efficiency is achieved.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and plant genetic engineering. Specifically, the present invention relates to a PL-LbCpf1-RR gene with high mutation efficiency in gene targeting and its application in rice gene targeting. Background technique [0002] The key to molecular breeding of crops is the efficient and directional creation of gene mutation materials. Cpf1 is a recently discovered site-specific nuclease, and the CRSIPR / Cpf1 system is an innate immune system in bacteria. Cpf1 can process crRNA precursor alone, and then use mature crRNA to specifically recognize and cut DNA. Utilizing this principle, in eukaryotic cells, by artificially synthesizing crRNA with Cpf1 binding and specific recognition target sites, Cpf1 can also guide Cpf1 to cut the target sequence in the genome. After the cell starts the DNA repair mechanism, the cleave There will be random base insertion or deletion at the site, thus realizing site...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/55C12N15/82A01H5/00
CPCC12N9/22C12N15/8213C12N15/8241
Inventor魏鹏程杨剑波许蓉芳李浩李莉秦瑞英李娟
OwnerRICE RES ISTITUTE ANHUI ACAD OF AGRI SCI