Aspergillus flavus avirulent strain and application of Aspergillus flavus avirulent strain in controlling pollution of Aspergillus flavus

A kind of Aspergillus flavus strain and aflatoxin technology, applied in the field of microbiology, can solve the problem of pathogenicity and achieve the effect of pollution control

Inactive Publication Date: 2017-09-19
FUJIAN AGRI & FORESTRY UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research report on Ash1 (Aflash1)-mediated histone methylation modification in Aspergillus flavus, and it is unknown whether Aflash1-mediated epigenetic modification has an impact on the pathogenicity of Aspergillus flavus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus flavus avirulent strain and application of Aspergillus flavus avirulent strain in controlling pollution of Aspergillus flavus
  • Aspergillus flavus avirulent strain and application of Aspergillus flavus avirulent strain in controlling pollution of Aspergillus flavus
  • Aspergillus flavus avirulent strain and application of Aspergillus flavus avirulent strain in controlling pollution of Aspergillus flavus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1, in Aspergillus flavus aflash1 gene knockout

[0044] Aspergillus flavus aflash1 Gene function in Aspergillus flavus morphogenesis and pathogenicity, first knockout in Aspergillus flavus aflash1 Gene.

[0045] figure 1 A shows the strategy for gene knockout. in vitro construction aflash1 Gene knockout fragment, through homologous recombination method, the 2.5 kb in the chromosome aflash1 Aspergillus fumigatus pyrG replacement, thereby knocking out the chromosomal aflash1 Gene.

[0046] The specific method is as follows:

[0047] Using the 5' primer CAGTAACGATCCTCGCAATTACTCCATG (p1); and the 3' primer TCGTGCGTGTGCTTATTGAGGTCT (p2); the upstream fragment of about 1.2 kb was amplified by PCR from the genomic DNA of Aspergillus flavus PTS strain; using the 5' primer TTTTGGGCTCGTTGGCTACATAGGAATAC (p3); and 3 'Primer AGCCTTCCAGGAGGATGAACCTG (p4); Amplify about 1.2kb downstream fragment by PCR from genomic DNA of Aspergillus flavus PTS strain; us...

Embodiment 2

[0048] Embodiment 2, aflatoxin extraction and analysis

[0049] Inoculate the Aspergillus flavus spores of each bacterial strain in YES liquid medium (concentration is 10 6 cells / mL), cultured in the dark at 29 ℃ for 6 days, then absorbed 500 µL of liquid medium, added an equal volume of chloroform, vortexed to mix, centrifuged at high speed for 5 min, absorbed the organic phase liquid, dried and re-introduced with 200 µL of chloroform Dissolve and sample 10 µL for thin-layer chromatography (TLC) analysis. figure 2 show knockout aflash1 After the gene, ⊿ Aflash1 The strain does not produce AFB1, AFB2, AFG1, and AFG2.

[0050] The wild-type Aspergillus flavus strain can synthesize aflatoxin in large quantities; aflash1 After gene complementation (Com- ash1 strains) aflatoxin synthesis levels recovered. Further Q-PCR analysis revealed that the knockout aflash1 after gene wxya , wxya , wxya , wxya , wxya genes, and wxya The expression of toxin-producing ...

Embodiment 3

[0051] Embodiment 3, aflash1 The Effect of Gene Knockout on Sporulation of Aspergillus flavus

[0052] Will WT, ⊿ Aflash1 and com -ash1 After the Aspergillus flavus strains were cultured on YES solid medium at 37 ℃ for 4 days, the sporulation of each strain was observed. It was found that on the artificial medium ⊿ Aflash1 The strain produced a large number of green spores, and the statistical analysis of the data also found that ⊿ Aflash1 The number of spores produced by the strain was more than three times that of WT, ( image 3 A, B, C).

[0053] This result shows that, aflash1 The deletion of the gene led to a significant increase in sporulation of Aspergillus flavus on the artificial medium.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Aspergillus flavus avirulent strain and an application of the Aspergillus flavus avirulent strain in controlling pollution of Aspergillus flavus. In the avirulent strain, the Aspergillus flavus does not express pathogenesis related genes aflash1. The strain is non-toxic, does not produce sclerotium, produces a large quantity of spores in a culture medium and a small quantity of spores on an organism and has low pathogenicity. On the basis of the characteristics of the strain, the invention further discloses a method for controlling pollution of the Aspergillus flavus by use of the strain. More specifically, the method comprises steps as follows: by use of the characteristics that the Aspergillus flavus strain is non-toxic, does not produce sclerotium, produces a large quantity of spores in a culture medium and a small quantity of spores on an organism and has low pathogenicity, limited ecological niches are scrambled in main peanut producing areas and other susceptible areas of Aspergillus flavus through the strain and wild toxic-producing Aspergillus flavus strains, the density of the wild toxic-producing Aspergillus flavus strains is effectively reduced, and Aspergillus flavus infection to crops, Aspergillus flavus toxin pollution and aspergillosis infection caused by Aspergillus flavus toxin pollution are effectively controlled and reduced.

Description

technical field [0001] The invention belongs to the field of microbiology, and in particular relates to an avirulent strain of Aspergillus flavus and its application for preventing and controlling pollution by Aspergillus flavus. Background technique [0002] Aspergillus flavus ( Aspergillus flavus ) is a saprophytic fungus widely distributed in nature, with a strong ability to grow and spread. Aflatoxin can parasitize in grain, food and feed for growth and reproduction, and produce aflatoxin, among which aflatoxin B1 (Aflatoxin B1, AFB1) is the most harmful, with strong liver toxicity and carcinogenic effect. At present, 25% of the world's crops are polluted by mycotoxins every year, and the most serious one is aflatoxin pollution. It is common for peanuts and corn to be contaminated by Aspergillus flavus in my country, and the contamination of Aspergillus flavus in livestock and poultry feed and aquatic feed is even more serious. As a result, aflatoxin can endanger human...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15A01G13/00C12R1/67
CPCC12N9/1007A01G13/00C12N9/93C12Y603/04002
Inventor庄振宏汪世华高媛媛李宇袁军胡育乐刘亚举
OwnerFUJIAN AGRI & FORESTRY UNIV