Method for regulating content of starch in corn kernel based on ZmMIKC2a gene

A technology of starch content and amylose content, applied in the field of genetic engineering, can solve the problem of less research on corn quality

Active Publication Date: 2017-10-17
INST OF TOBACCO ANHUI ACADEMY OF AGRI SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chinese researchers have made important contributions to improving maize yield, but there are few studies on improving maize quality

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating content of starch in corn kernel based on ZmMIKC2a gene
  • Method for regulating content of starch in corn kernel based on ZmMIKC2a gene
  • Method for regulating content of starch in corn kernel based on ZmMIKC2a gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The present embodiment provides a kind of method that improves corn grain amylose content and amylose / total starch ratio, comprises the following steps:

[0036] (1) Cloning of ZmMIKC2a gene

[0037] Grain endosperm of corn B73 variety 16 days after pollination was selected, and corn endosperm RNA was extracted and reverse-transcribed into cDNA. Using corn endosperm cDNA as a template, according to the gene sequence published in the corn B73 genome database, combined with the pZZ00005 plant expression vector (vector map as shown in figure 1 Shown) design primers for the multiple cloning site, perform PCR amplification, and obtain PCR amplification products.

[0038] The primer sequences are:

[0039] MIKC2a-F-1:5′-CGC GGATCC ATGGGTAGGGGAAGGATTGA-3′

[0040] MIKC2a-R-1:5′-AA CTGCAG TTAGAACTGATGATGAGGGTTATTG-3′

[0041] The PCR reaction program was: 98°C, pre-denaturation for 10 min; 98°C, denaturation for 20 s; 60°C, annealing for 20 s; 72°C, extension for 2 min, ...

Embodiment 2

[0068] The present embodiment provides a kind of method that reduces corn grain amylose content and amylose / total starch ratio, comprises the following steps:

[0069] (1) Cloning of ZmMIKC2a gene RNAi interference sequence MIKC2a-RNAi

[0070] The grain endosperm of corn B73 variety 16 days after pollination was used as raw material to clone the ZmMIKC2a gene and connect it to the T vector to obtain the recombinant plasmid T-MIKC2a. For specific steps, refer to step (1) of Example 1.

[0071] Using T-MIKC2a as a template, according to the ZmMIKC2a gene sequence, combined with the pUCCRNAi interference vector (the vector map is as follows image 3 Shown) design primers for the multiple cloning site, perform PCR amplification, and obtain PCR amplification products.

[0072] The primer sequences are:

[0073] MIKC2a-RNAi-F:GC TCTAGA GTCGCCTCTACGAGTATGCCAACA

[0074] MIKC2a-RNAi-R:GG ACTAGT TGACAGGTTTCCCACGGAATCAC

[0075] The PCR reaction program was: 98°C, pre-denatur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating the content of starch in a corn kernel based on a ZmMIKC2a gene and belongs to the technical field of gene engineering. The method comprises the following steps: I) constructing a ZmMIKC2a gene over-expression vector to obtain a ZmMIKC2a gene over-expression plant; II) knocking out the ZmMIKC2a gene in a target corn to obtain a ZmMIKC2a gene deletion plant. The method disclosed by the invention has the advantages that the positive regulation effect of the ZmMIKC2a gene on corn kernel starch synthesis related genes is utilized; the content of amylose in the target corn and the ratio of the amylase to total starch are improved or reduced through a gene engineering method, so that a new transgenic corn variety with high amylose, low amylopectin or high amylopectin / low amylose is obtained; the method is of great practical significance in developing the new transgenic corn variety with a specific function by utilizing a gene engineering technology.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for regulating corn grain starch content based on the ZmMIKC2a gene. Background technique [0002] Corn occupies an important position in all kinds of production and life of human beings. It is not only the main food crop, but also the main source of starch in all kinds of production. Chinese researchers have made important contributions to improving maize yield, but there are few studies on improving maize quality. Starch is the main component of plant seed endosperm, and its content and quality directly affect the quality of seeds. Therefore, it is of great significance to study the regulation of starch synthesis to improve the quality of seeds. [0003] Starch is divided into amylose and amylopectin according to different structures. The ratio of amylose and amylopectin in starch and the branch chain structure of amylopectin determine the quality of corn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/10
CPCC07K14/415C12N15/8245
Inventor董庆李廷春王俊王芳张玮陈洪俭李成
OwnerINST OF TOBACCO ANHUI ACADEMY OF AGRI SCI