Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine epidemic diarrhea virus and culture method and application thereof

A porcine epidemic diarrhea and virus technology, applied in the direction of viruses, antiviral agents, virus antigen components, etc., can solve the problems of poor treatment effect and difficult prevention, and achieve the effect of good immunogenicity and strong pathogenicity

Inactive Publication Date: 2017-10-31
BEIJING DAWEIJIA BIOTECH SHARE CO LTD
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there is no specific drug for the treatment of porcine epidemic diarrhea, and the effect of conventional treatment is not good. Therefore, vaccine prevention is still the main method. Although commercial vaccines for porcine epidemic diarrhea have been used in pigs, the virus still appears in the In immunized pigs, it has brought great difficulties to the prevention of the disease, so finding a new strain with high immunogenicity is of great significance for the development of preventive measures and diagnostic methods for porcine epidemic diarrhea

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine epidemic diarrhea virus and culture method and application thereof
  • Porcine epidemic diarrhea virus and culture method and application thereof
  • Porcine epidemic diarrhea virus and culture method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0026] Embodiment 1: Isolation and cultivation of virus

[0027] The small intestine of piglets with diarrhea was sent to a pig farm in Ningbo City, Zhejiang Province. The intestinal wall and contents were collected and tested by RT-PCR. The result was positive for porcine epidemic diarrhea antigen, and porcine epidemic diarrhea virus PEDV / CH / NB was obtained / 2014 ( figure 1 ).

[0028] Take an appropriate amount of the small intestine submitted for inspection, scrape the intestinal mucosa and contents, add physiological saline according to the ratio of 1:5 (weight: volume), grind, freeze and thaw repeatedly 3 times, centrifuge at 8000r / min for 10min, take the supernatant, 0.22μm Membrane filtration, the resulting treatment solution for disease material was subpackaged and stored in a -80°C refrigerator for later use.

[0029] Cultivate Vero cells with cell culture medium to form a cell monolayer, discard the growth medium of the monolayer of Vero cells, wash the cells 3 tim...

specific Embodiment approach 2

[0031] Specific embodiment 2: RT-PCR detection of cell culture

[0032] PEDV / CH / NB / 2014 5th, 10th, 15th, 20th, and 25th passage cell cultures were taken 250 μL respectively, and RNA was extracted using the Total RNA Kit II kit produced by OMEGA Company. The extracted RNA was reverse-transcribed: 6 μL of RNA was mixed with 1 μL Oligo(dT), heated at 70°C for 10 min, and quickly placed in an ice bath for 2 min. Add 2 μL 5×Buffer, 0.5 μL 10 mM dNTP mix, 0.25 μL MLV reverse transcriptase and 0.25 μL RNase Inhibitor to the mixture. After mixing, react according to the following conditions: 42°C, 60 min; 70°C, 15 min.

[0033] The reverse-transcribed cDNA was subjected to PCR with the following primers to amplify the N gene, upstream primer NF: 5'CGGTTCTCACAGATAGTGAG 3', SEQ ID NO: 17; downstream primer NR: 5'CGCTAGAAAAACACTCAGTAAT 3', SEQ ID NO: 18. The reaction system is: cDNA 1 μL, 2×Taq Mix 12.5 μL, 10 μM / mL upstream and downstream primers 0.5 μL each, add deionized water to 25...

specific Embodiment approach 3

[0035] Specific embodiment 3: detection of virus titer

[0036] The virus titer of PEDV / CH / NB / 2014 was determined by microtitration method, and the method was as follows: Vero cells were used to measure the virus titer. Use a 96-well cell culture plate to cultivate Vero cells, dilute the virus from 10-1 to 10-10 with DMEM without serum, and inoculate 100 μL of each dilution of the virus solution into the culture wells covered with Vero cells, Inoculate 8 wells for each dilution, and set negative cell control wells at the same time. Place it in a 37°C, 5% CO2 incubator, observe the virus infection of the cells in 4-6 days, and calculate the virus titer. The highest virus price can reach 108.5TCID50 / ml.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a porcine epidemic diarrhea virus and its cultivation method and application. The virus strain is a porcine epidemic diarrhea virus of the family Coronaviridae, named as PEDV / CH / NB / 2014, and the preservation number is CGMCC No.12041. The virus was cultured using DMEM without trypsin and supplemented with 2% fetal calf serum as a maintenance solution. And stably proliferate efficiently in Vero cells, the virus titer can reach 108.0TCID50 / mL, no exogenous virus pollution, has strong pathogenicity to piglets, when the virus titer reaches 103TCID50, it can cause piglets to become ill, which is the current domestic The popular variant virulent strain is used for preparing PEDV diagnostic reagents and vaccines, has good immunogenicity, and can make up for the shortage of existing vaccine types.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an epidemic diarrhea virus and its application. Background technique [0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious enteric infectious disease caused by porcine epidemic diarrhea virus (PEDV), characterized clinically by watery diarrhea, vomiting, and dehydration . Pigs of all ages are susceptible, especially suckling piglets. PED is widely distributed in the world, the United Kingdom, Belgium, France, Hungary, Canada and other countries have reported the occurrence of this disease. According to reports, PED has occurred quite seriously in Asian countries in recent years. Japan, South Korea, and Thailand have all experienced pandemics, with high mortality and serious harm, causing huge economic losses to the pig industry. [0003] At present, there is no specific drug for the treatment of porcine epidemic diarrhea, and the effect of convent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/00A61K39/215A61P31/14A61P1/12C12Q1/70
CPCC12N7/00A61K39/12C12N2770/20021C12N2770/20034C12Q1/70
Inventor 闫雷张晓杰李爽张美美金忠辉乔琳
Owner BEIJING DAWEIJIA BIOTECH SHARE CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com