Quantitative detection method of mutant gene

A quantitative detection method and mutation gene technology, applied in the field of high-fidelity deep sequencing detection, can solve the problems of insufficient sample volume, high cost of digital PCR, large amount of DNA, etc., achieve high sensitivity and avoid the effect of low connection efficiency

Active Publication Date: 2022-01-18
嘉兴金弗康医学检验实验室有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With such 10,000 original copies, about 2,000 DNA molecules derived from the original template can be obtained. Although sufficient sequences can be achieved by PCR amplification for 5,000 times and 10,000 times of sequencing, the number of sequences due to the original template has not increased, although the depth Very deep and cannot represent the depth of 10,000 original templates
More than 30 cycles of PCR will inevitably produce a high proportion of mismatch errors, seriously affecting the fidelity and sensitivity of sequencing
The obvious limitations of this method are that, first, digital PCR can only detect 1-2 genes with mutations at known and determined sites in one reaction, and cannot reliably detect mutations at unknown sites in samples at the same time, because tumor mutations are complex, Multi-gene and multi-locus mutations are an important feature of tumors, and multi-gene and multi-locus detection is very important, so the current digital PCR cannot well meet the needs of tumor plasma multi-locus mutation detection
Second, the amount of DNA required for digital PCR is relatively large. Generally, 10ML of blood is only enough for one reaction and 1-2 sites to be tested. If more sites are to be tested, the sample volume is not enough.
3. Only 1-2 sites are detected. For tumors, the detection coverage is too low and the application area is too narrow
In tumor tissue and peripheral blood of tumor patients, the detection of similar multi-site hot spot mutations is the most frequent, while single-site mutations are rare, so the applicability is low, and it has not been widely used so far.
4. The cost of digital PCR is too high. To detect a site, the material cost alone needs 200 to 400 yuan
So far, it has only been used in the field of scientific research, and it cannot be used for actual medical testing.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantitative detection method of mutant gene
  • Quantitative detection method of mutant gene
  • Quantitative detection method of mutant gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Detection of Codon 12 and Codon 13 Mutations of Kras Gene in Peripheral Blood Plasma

[0045] 1. Sample DNA extraction

[0046] An appropriate amount of peripheral blood plasma from tumor patients was taken, and the cell-free genomic DNA was extracted with a cell-free DNA extraction kit (DK607-01, provided by Shanghai Laifeng Biotechnology Co., Ltd.).

[0047] 2. Level 1 Targeted Synthesis Amplification

[0048] Reverse primer K-ras-41bp-R: T (biotin modified) TGCTCTTCCGATC-GTTCGTCCACAAAATGATTCTGA (SEQ ID NO: 1)

[0049] The reaction system of primary targeted synthesis amplification PCR is: 2 μL of 5×PCR buffer, 0.5 μL of 10 mM dNTP, 1 μL of DNA template, 1 μL of 5 μM reverse primer, 0.2 μL of 5 U / μl KOD DNA polymerase, H 2 O 5.8 μL, total volume 10 μL.

[0050] Reaction conditions are as shown in table 1:

[0051] Table 1 Reaction conditions for primary targeted synthesis amplification PCR

[0052]

[0053]

[0054] 3. Single-stranded product capt...

Embodiment 2

[0100] Example 2 Detection of hot zone mutations in peripheral blood plasma polygenes (Kras, Pten)

[0101] Detection method and condition are basically the same as in Example 1, except that:

[0102] In step 2, in the first-level targeted synthesis amplification reaction, in addition to the reverse primer K-ras-41bp-R, the primers used also have a reverse primer Pten-46bp-R: T (biotin modified) TGCTCTTCCGATC-AGTATCGGTTGGCTTTGTCT( SEQ ID NO: 12);

[0103] In step 4, in the protective excision purification reaction of the 3' end of the primary product, in addition to adding the sequence shown in SEQ ID NO: 2, the sequence: CGTGCAGATAATGACAAGGAAT (SEQ ID NO: 13);

[0104] In step 5, in the secondary single-strand synthesis amplification reaction, the primers used, in addition to the forward primer K-ras-41bp-F, also have a forward primer Pten-46bp-F: C (phosphorylated modification) GCTCTTCCGATCT- CGTGCAGATAATGACAAGGAAT (SEQ ID NO: 14);

[0105] In step 6, in the protective ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quantitative detection method for a mutant gene. The steps include: 1) extracting sample DNA; 2) single-strand synthesis reaction; 3) microsphere capture purification; 4) 3' end protective excision purification on the microsphere reaction; 5) using the product of step 4) as a template to carry out a single-strand synthesis reaction on the microsphere, and to separate and remove the microsphere; 6) a protective excision purification reaction at the 3' end; 7) a double-ended adapter bridging reaction, and Purification; 8) Using the previous purification product as a template, repeat the single-strand synthesis reaction and the 3' end protective excision purification reaction; 9) Quantification, sequencing, and judgment of the mutant gene. This method uses the target gene fragment as a template to carry out repeated multi-cycle single-strand synthesis reactions, and converts the bases of a series of sites on the original template into complementary sequences, so that the target gene sequence can be transformed and synthesized with maximum fidelity. After multi-stage single-strand synthesis , to obtain a sufficient amount of complete sequences to be tested for sequencing, which improves the detection sensitivity and fidelity of low-proportion mutant genes.

Description

technical field [0001] The invention relates to the technical field of DNA deep sequencing detection, in particular to high-fidelity deep sequencing detection of DNA fragments with a low proportion of 10% to 0.05% target sequence variation sites in tissue, plasma or serum. Background technique [0002] Gene science is an important field of life science. The genetic code sequence and its variation of living organisms will affect various biological functions of living organisms, resulting in functional variation. By detecting the genetic variation of living organisms, the functional variation of life can be understood and estimated. By quantitatively detecting the genetic variation of living organisms, it is also possible to accurately understand the disease progression and prognosis of diseased living organisms, such as tumor progression, recurrence or early, middle and late stages, and treatment effects. At present, the detection of gene mutations has become an important mea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6869
CPCC12Q1/6827C12Q1/6869
Inventor黄新华戴慧清
Owner嘉兴金弗康医学检验实验室有限公司