New strain of Corynebacteria styli and its cultivation method and use
A technology of I. clavulatus and thin stalk, which is applied in the field of new strains of I. clavulatus and its cultivation, and can solve the problems of lack of research and understanding of wild edible and medicinal fungi.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] 1. The cultivation method of the new strain of I. tenoides (CCTCC No: M2017430), the culture medium is as follows:
[0067] The components (percentage by weight) of the medium for separating the mother species are: 20% of potatoes, 2% of glucose, 2% of agar, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, vitamin B 1 Trace, 0.5% silkworm chrysalis powder, the rest is water.
[0068] The components (percentage by weight) of the purified parent medium are: 0.5% peptone, 1% glucose, 0.1% potassium dihydrogen phosphate, magnesium sulfate (MgSO4 7H 2 O) 0.05%, agar 2%, 1 / 3000 Bengal red solution 10%, chloramphenicol 0.01%, 0.5% silkworm chrysalis powder, and the rest is water.
[0069] Components (percentage by weight) of the original seed medium: 20% of potatoes, 2% of glucose, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, trace amounts of vitamin B1, 0.5% of silkworm chrysalis powder, and the rest is water.
[0070] Components of...
Embodiment 2
[0089] Embodiment 2 strain identification
[0090] Gather the wild fruiting body of bacterial classification of the present invention in the Shuangkengkou Protection Station of Wuyanling National Nature Reserve, Zhejiang, such as figure 2 As shown, the pure culture was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit , to obtain a DNA solution.
[0091] The ITS-PCR experiment was carried out by the universal primer ITS1 / ITS4 (primer 1ITS1:TCCGTAGGTGAACCTGCGG, primer 2ITS4:TCCTCCGCTTATTGATATGC) of the fungal ribosomal intergenic region, and the composition of the PCR reaction solution (50 μl in total) was:
[0092]
[0093] The reaction conditions are:
[0094] React at 94°C for 5min; react at 94°C for 1min, react at 55°C for 1min, and react at 72°C for 1min, 30 cycles; react at 72°...
Embodiment 3
[0097] The active ingredient analysis of the Isydium tenosporum of embodiment 1
[0098] Carry out compositional analysis to the I. tenifolia obtained in Example 1, and adopt the analysis result of Cordyceps sinensis from "Chinese Cordyceps" in 2008, compiled by the Northwest Institute of Plateau Biology of the Chinese Academy of Sciences and the Qinghai Provincial Drug Inspection Institute as a reference, and detect The results and methods are shown in Table 1.
[0099] Table 1 Component analysis results of I. tenoides
[0100]
[0101]
[0102] From the active ingredient analysis in Table 1, it can be seen that the protein content of I. tenoides of the present invention is as high as 51.4g / 100g, which is a kind containing high protein components, which is more than 1 times higher than the protein content of Cordyceps sinensis, and contains proteins that Cordyceps sinensis does not have. Cordycepin.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


