New strain of Corynebacteria styli and its cultivation method and use

A technology of I. clavulatus and thin stalk, which is applied in the field of new strains of I. clavulatus and its cultivation, and can solve the problems of lack of research and understanding of wild edible and medicinal fungi.

Active Publication Date: 2019-09-17
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still a large number of wild edible and medicinal fungi that have not been recognized by humans and have not been studied.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New strain of Corynebacteria styli and its cultivation method and use
  • New strain of Corynebacteria styli and its cultivation method and use
  • New strain of Corynebacteria styli and its cultivation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] 1. The cultivation method of the new strain of I. tenoides (CCTCC No: M2017430), the culture medium is as follows:

[0067] The components (percentage by weight) of the medium for separating the mother species are: 20% of potatoes, 2% of glucose, 2% of agar, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, vitamin B 1 Trace, 0.5% silkworm chrysalis powder, the rest is water.

[0068] The components (percentage by weight) of the purified parent medium are: 0.5% peptone, 1% glucose, 0.1% potassium dihydrogen phosphate, magnesium sulfate (MgSO4 7H 2 O) 0.05%, agar 2%, 1 / 3000 Bengal red solution 10%, chloramphenicol 0.01%, 0.5% silkworm chrysalis powder, and the rest is water.

[0069] Components (percentage by weight) of the original seed medium: 20% of potatoes, 2% of glucose, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, trace amounts of vitamin B1, 0.5% of silkworm chrysalis powder, and the rest is water.

[0070] Components of...

Embodiment 2

[0089] Embodiment 2 strain identification

[0090] Gather the wild fruiting body of bacterial classification of the present invention in the Shuangkengkou Protection Station of Wuyanling National Nature Reserve, Zhejiang, such as figure 2 As shown, the pure culture was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit , to obtain a DNA solution.

[0091] The ITS-PCR experiment was carried out by the universal primer ITS1 / ITS4 (primer 1ITS1:TCCGTAGGTGAACCTGCGG, primer 2ITS4:TCCTCCGCTTATTGATATGC) of the fungal ribosomal intergenic region, and the composition of the PCR reaction solution (50 μl in total) was:

[0092]

[0093] The reaction conditions are:

[0094] React at 94°C for 5min; react at 94°C for 1min, react at 55°C for 1min, and react at 72°C for 1min, 30 cycles; react at 72°...

Embodiment 3

[0097] The active ingredient analysis of the Isydium tenosporum of embodiment 1

[0098] Carry out compositional analysis to the I. tenifolia obtained in Example 1, and adopt the analysis result of Cordyceps sinensis from "Chinese Cordyceps" in 2008, compiled by the Northwest Institute of Plateau Biology of the Chinese Academy of Sciences and the Qinghai Provincial Drug Inspection Institute as a reference, and detect The results and methods are shown in Table 1.

[0099] Table 1 Component analysis results of I. tenoides

[0100]

[0101]

[0102] From the active ingredient analysis in Table 1, it can be seen that the protein content of I. tenoides of the present invention is as high as 51.4g / 100g, which is a kind containing high protein components, which is more than 1 times higher than the protein content of Cordyceps sinensis, and contains proteins that Cordyceps sinensis does not have. Cordycepin.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a new bacterial strain and its cultivation method and application, in particular to a new bacterial strain of Isychosporium tenosporum and its cultivation method and application, and the new bacterial strain of Isycinium tenosporum is Isaria tenuipes HMGIM‑W150712, deposit number is CCTCC No: M2017430. The method comprises separating and purifying the mother seed, preparing liquid original seed, inoculating the liquid original seed into the cultivation medium, and then performing cultivation management. Through the inventor's trial and error research, the cultivation medium and the cultivation method suitable for the new bacterial strain of I. tenoides of the present invention have been obtained through exploration, and the artificial cultivation of I. tenoides can be successfully realized. After the artificial cultivation, its fruiting body Compared with wild strains, the length is greatly increased, the biotransformation rate of head tide is about 33.36%, and the fruiting period is short.

Description

technical field [0001] The invention relates to a new bacterial strain and its cultivation method and application, in particular to a new bacterial strain of I. tenosporum as well as its cultivation method and application. Background technique [0002] At present, the edible fungus industry is developing rapidly. The annual output of edible fungi in my country has reached more than 20 million tons, accounting for more than 75% of the world, and the number of employees exceeds 20 million. The fifth place after that surpassed fruit, tea and sericulture. Among them, medicinal fungi, such as Ganoderma lucidum, Cordyceps, etc., and their processed products, have an annual output value of tens of billions. [0003] With the gradual rise of people's living standards, the requirements for the quality of life are higher. Because macrofungi are rich in various components with nutritional and functional effects, including fungal polysaccharides, triterpenoids, sterols, etc., they have ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14A01H15/00A01G18/00A01G18/20A01G18/40A61K36/062A61P35/00C12R1/645
CPCA01H15/00A61K36/062A01G18/00C12N1/14C12N1/145C12R2001/645
Inventor 胡惠萍莫伟鹏卓丽君史钏谢意珍
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap