Unlock instant, AI-driven research and patent intelligence for your innovation.

Induction method of multilayer casparian band in plant roots

A technology of Kjeldahl belt and plant root, applied in the field of agricultural biology, can solve the problem of not being able to form Kjeldahl belt

Active Publication Date: 2018-01-09
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, assays have shown that expression of SHR or MYB36 does not form fully functional Caspian bands

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Induction method of multilayer casparian band in plant roots
  • Induction method of multilayer casparian band in plant roots

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 SHR and MYB36 expression system construction

[0020] Arabidopsis root RNA was extracted according to the instructions of the E.Z.N.A.® Plant RNA Kit kit from OMEGA. Then it was reverse transcribed into cDNA according to the instructions of TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TRANS). Find the cDNA sequences of SHR and MYB36 on the TAIR website (http: / / www.arabidopsis.org / ), design primers SHR(+):5'GGGGACAAGTTTGTACAAAAAGCAGGCTTCATGGATACTCTCTTTTAGA3' and SHR(-):5'GGGGACCACTTTGTACAAGAAAGCTGGGTTCGTTGGCCGCCACGCACT3'; MYB36(+): 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGAAGAGCTCCATGC3' and MYB36(-):5'GGGGACCACTTTGTACAAGAAAGCTGGGTTAACACTGTGGTAGCTCATCTGA3', PCR amplified target fragment, recovered product, and ligated the recovered fragment to the entry cloning vector pDONR221 by BP reaction (for plasmid information, see https: / / www.thermofisher.com / order / catalog / product / 12536017). Prepare DH5α competent, transfer the ligated product in...

Embodiment 2

[0021] Embodiment 2: establishment of plant expression system

[0022] (1) To prepare GV3101 Agrobacterium competent cells, respectively transfer the pG1090-XVE:SHR and pG1090-XVE:MYB36 plasmids into Agrobacterium, add 50mg / L rifampicin and 15mg / L spectinomycin with 100mg / L Positive colonies were screened with L-gentamicin.

[0023] (2) Arabidopsis seeds were placed in a refrigerator at 4°C for 3-4 days at low temperature, and high-temperature sterilized culture substrates (nutritional soil: vermiculite: perlite = 5:3:1) were filled into the culture pots. Sow 5-6 seeds evenly in the pots, cover with film for 3-4 days, and put them in a growth room for cultivation (22-23°C, light for 16h). After Arabidopsis bolted, cut off all the inflorescences from the bottom of the main inflorescence with scissors, and after the inflorescences were pulled out again and formed a large number of immature flower clusters, they could be used for transformation.

[0024] (3) Prepare the Agrobac...

Embodiment 3

[0028] Embodiment 3: small peptide treatment

[0029] (1) Search the small peptide amino acid sequence on the TAIR website, CIF1: DYGNSPSPPRLERPPFKLIPN, CIF2: DYGHSSPKPKLVRPPFKLIPN, the company synthesized small peptides.

[0030] (2) Take a small amount of screened homozygous transgenic seeds, pour them into plastic centrifuge tubes, open the lid, place them in a glass sealed jar, add 45mL sodium hypochlorite and 5mL concentrated hydrochloric acid to the small beaker in the sterilized jar, and quickly seal the The cylinder is sealed and sterilized for 2.5-3 h. All the above operations were performed in a fume hood. After the sterilization is completed, put the seeds on the ultra-clean bench and blow for half an hour, and use a toothpick to spot the seeds on the 1 / 2 MS plate. Low-temperature treatment in a refrigerator at 4°C for 3-4 days, and culture in an incubator at 22°C for 5 days under light. Move the seedlings to 1 / 2 MS medium containing 10 μM small peptide (CIF1 or ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an induction method of multilayer casparian band in plant roots. According to an application method, plant transcription factor SHORT-ROOT(SHR) or MYB36 is used, induction of casparian band in plant roots is realized via combination with plant source small peptides CIF1 and CIF2. Composed (using 35S promoter) or induced (estrogen is used for induction of an expression system) expression of SHR or MYB36 is adopted, induction of a plurality of genes, including CASP family, PER64, ESB family, SGN1, and SGN3, involved in casparian band synthesis in plant root mediopellis cells and other elementary tissue cells is realized. Casparian band with complete functions can be formed by plant root mediopellis cells and other elementary tissue cells. The application potentiality in crop biotechnology modification is large.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to a method for inducing the formation of Caspian bands in plant roots. Background technique [0002] Casparian strips are suberized and lignified bands of radial and transverse walls of cells in the endodermis of higher plants. The suberized Kjeldahl zone forms an impenetrable barrier to water and solutes, so that the continuity of the apoplast in higher plant roots is interrupted here. After water and mineral elements are absorbed by the root epidermis, they can be transported laterally to the vascular bundle along two pathways: one is the apoplast in the intercellular space; the other is the symplast pathway inside the cell. When water and solutes reach the endothelial layer, the apoplast pathway of water and solutes is blocked due to the presence of suberized zonal Kjeldahl bands, and they must be selectively absorbed through the endothelial cells via the s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00
CPCC12N15/82
Inventor 吴双李朋雪于巧芝许春苗顾旭
Owner FUJIAN AGRI & FORESTRY UNIV