Induction method of multilayer casparian band in plant roots
A technology of Kjeldahl belt and plant root, applied in the field of agricultural biology, can solve the problem of not being able to form Kjeldahl belt
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 SHR and MYB36 expression system construction
[0020] Arabidopsis root RNA was extracted according to the instructions of the E.Z.N.A.® Plant RNA Kit kit from OMEGA. Then it was reverse transcribed into cDNA according to the instructions of TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TRANS). Find the cDNA sequences of SHR and MYB36 on the TAIR website (http: / / www.arabidopsis.org / ), design primers SHR(+):5'GGGGACAAGTTTGTACAAAAAGCAGGCTTCATGGATACTCTCTTTTAGA3' and SHR(-):5'GGGGACCACTTTGTACAAGAAAGCTGGGTTCGTTGGCCGCCACGCACT3'; MYB36(+): 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGAAGAGCTCCATGC3' and MYB36(-):5'GGGGACCACTTTGTACAAGAAAGCTGGGTTAACACTGTGGTAGCTCATCTGA3', PCR amplified target fragment, recovered product, and ligated the recovered fragment to the entry cloning vector pDONR221 by BP reaction (for plasmid information, see https: / / www.thermofisher.com / order / catalog / product / 12536017). Prepare DH5α competent, transfer the ligated product in...
Embodiment 2
[0021] Embodiment 2: establishment of plant expression system
[0022] (1) To prepare GV3101 Agrobacterium competent cells, respectively transfer the pG1090-XVE:SHR and pG1090-XVE:MYB36 plasmids into Agrobacterium, add 50mg / L rifampicin and 15mg / L spectinomycin with 100mg / L Positive colonies were screened with L-gentamicin.
[0023] (2) Arabidopsis seeds were placed in a refrigerator at 4°C for 3-4 days at low temperature, and high-temperature sterilized culture substrates (nutritional soil: vermiculite: perlite = 5:3:1) were filled into the culture pots. Sow 5-6 seeds evenly in the pots, cover with film for 3-4 days, and put them in a growth room for cultivation (22-23°C, light for 16h). After Arabidopsis bolted, cut off all the inflorescences from the bottom of the main inflorescence with scissors, and after the inflorescences were pulled out again and formed a large number of immature flower clusters, they could be used for transformation.
[0024] (3) Prepare the Agrobac...
Embodiment 3
[0028] Embodiment 3: small peptide treatment
[0029] (1) Search the small peptide amino acid sequence on the TAIR website, CIF1: DYGNSPSPPRLERPPFKLIPN, CIF2: DYGHSSPKPKLVRPPFKLIPN, the company synthesized small peptides.
[0030] (2) Take a small amount of screened homozygous transgenic seeds, pour them into plastic centrifuge tubes, open the lid, place them in a glass sealed jar, add 45mL sodium hypochlorite and 5mL concentrated hydrochloric acid to the small beaker in the sterilized jar, and quickly seal the The cylinder is sealed and sterilized for 2.5-3 h. All the above operations were performed in a fume hood. After the sterilization is completed, put the seeds on the ultra-clean bench and blow for half an hour, and use a toothpick to spot the seeds on the 1 / 2 MS plate. Low-temperature treatment in a refrigerator at 4°C for 3-4 days, and culture in an incubator at 22°C for 5 days under light. Move the seedlings to 1 / 2 MS medium containing 10 μM small peptide (CIF1 or ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

