Method for higher fungi gene disruption
A technology of genes and fungi, applied in the field of genetic engineering, can solve problems such as unclear genetic background of higher fungi, and achieve long-term, difficult and easy-to-operate effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Codon optimization of the Cas9 gene and isolation of the gene.
[0045] The specific operation of this embodiment includes: by analyzing the Cas9 coding gene of Streptococcus pyogenes, combined with the codon bias in the Ganoderma lucidum genome, optimizing the Cas9 coding gene as Seq ID No.1 (including SV40NLS nuclear import signal). Gene synthesis was performed by GenScript (Nanjing, China). The codon-optimized Cas9 gene can be isolated by PCR with primers Cas9-F: 5'ATGGACAAGAAGTACAGCATCGG3' (Seq ID No.2) and Cas9-R: 5'TTAGACCTTGCGCTTCTTCTTGGG 3' (Seq ID No.3).
[0046] The nucleotide sequence of the Cas9 gene of described codon optimization is as shown in Seq ID No.1, and this sequence (SEQ IDNo.1) is made up of 4140 deoxynucleotides, from the 5' end of SEQ ID No.1 The 1st-4140th nucleotide is the open reading frame (Open Reading Frame, ORF) of the Cas9 gene, and the 1st-3rd nucleotide from the 5' end of SEQ ID No.1 is the initiation codon of the Cas9 gene ATG, the...
Embodiment 2
[0050] A codon-optimized Cas9 gene expression vector was constructed and transformed into Ganoderma lucidum cells.
[0051] In this example, a codon-optimized Cas9 expression vector was constructed by using pMD18-T (containing Amp screening marker, purchased from Takara Company) as the backbone, using the endogenous gpd constitutive promoter of Ganoderma lucidum, Trichoderma pdc terminator, Ganoderma lucidum Endogenous sdhB resistance gene (with carboxin resistance phenotype), this expression vector is used for transformation of Ganoderma lucidum cells.
[0052] 1) Extraction of Ganoderma lucidum genomic DNA.
[0053] Weigh 0.1-0.2g freeze-dried Ganoderma lucidum (Ganoderma lucidum, CGMCC NO.5.26) and grind it into powder in liquid nitrogen, transfer the powder into 1.5mL, and extract the buffer solution (100mmol / L Tris-HCl buffer (pH 8.0), 20mmol / L EDTA-Na 2 , 1.4mol / L NaCl, 2% CTAB, add 0.1% (V / V) β-mercaptoethanol) before use, incubate at 65°C for 30min, then centrifuge a...
Embodiment 3
[0069] The method for transcribing gRNA in vitro and transforming host cells specifically comprises the following steps:
[0070] 1) Construction of gRNA in vitro transcription template.
[0071] Using the method of artificially synthesizing gRNA, and synthesizing the target homologous fragment sequence (the target gene is ura3), select two gRNA sequences at different positions of the ura3 gene, and use the following primers:
[0072] Forward primer Glura-F1 (Seq ID No.10):
[0073] 5' TAATACGACTCACTATA GGAGCAGAAGCCCCCTGCCAGTTTTTAGAGCTAGAAATAGC 3'
[0074] and reverse primer ble-R (Seq ID No.11):
[0075] 5' ACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAG 3'
[0076] The target fragment was amplified, in which the T7 promoter was introduced by the forward primer (the sequence is underlined). After the PCR product was purified and recovered, it was ligated into pMD-18T by TA cloning, transformed into Escherichia coli DH5α, picked the transformant, verified the tr...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com