Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for gene disruption in higher fungi

A gene and fungus technology, applied in the field of genetic engineering, can solve the problems of unclear genetic background of higher fungi, and achieve the effects of long time, difficulty and easy operation.

Active Publication Date: 2021-01-08
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although CRISPR / Cas9 technology has the advantages of high efficiency, strong specificity, and easy operation, due to the unclear genetic background of higher fungi, there are two major challenges in developing CRISPR / Cas9 technology in such microorganisms. The Cas9 gene expressed in the medium, and the second is the gRNA that ensures effective expression in higher fungi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for gene disruption in higher fungi
  • Method for gene disruption in higher fungi
  • Method for gene disruption in higher fungi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Codon optimization of the Cas9 gene and isolation of the gene.

[0045] The specific operation of this embodiment includes: by analyzing the Cas9 coding gene of Streptococcus pyogenes, combined with the codon bias in the Ganoderma lucidum genome, optimizing the Cas9 coding gene as Seq ID No.1 (including SV40NLS nuclear import signal). Gene synthesis was performed by GenScript (Nanjing, China). The codon-optimized Cas9 gene can be isolated by PCR with primers Cas9-F: 5'ATGGACAAGAAGTACAGCATCGG3' (Seq ID No.2) and Cas9-R: 5'TTAGACCTTGCGCTTCTTCTTGGG 3' (Seq ID No.3).

[0046] The nucleotide sequence of the Cas9 gene of described codon optimization is as shown in Seq ID No.1, and this sequence (SEQ IDNo.1) is made up of 4140 deoxynucleotides, from the 5' end of SEQ ID No.1 The 1st-4140th nucleotide is the open reading frame (Open Reading Frame, ORF) of the Cas9 gene, and the 1st-3rd nucleotide from the 5' end of SEQ ID No.1 is the initiation codon of the Cas9 gene ATG, the...

Embodiment 2

[0050] A codon-optimized Cas9 gene expression vector was constructed and transformed into Ganoderma lucidum cells.

[0051] In this example, a codon-optimized Cas9 expression vector was constructed by using pMD18-T (containing Amp screening marker, purchased from Takara Company) as the backbone, using the endogenous gpd constitutive promoter of Ganoderma lucidum, Trichoderma pdc terminator, Ganoderma lucidum Endogenous sdhB resistance gene (with carboxin resistance phenotype), this expression vector is used for transformation of Ganoderma lucidum cells.

[0052] 1) Extraction of Ganoderma lucidum genomic DNA.

[0053] Weigh 0.1-0.2g freeze-dried Ganoderma lucidum (Ganoderma lucidum, CGMCC NO.5.26) and grind it into powder in liquid nitrogen, transfer the powder into 1.5mL, and extract the buffer solution (100mmol / L Tris-HCl buffer (pH 8.0), 20mmol / L EDTA-Na 2 , 1.4mol / L NaCl, 2% CTAB, add 0.1% (V / V) β-mercaptoethanol) before use, incubate at 65°C for 30min, then centrifuge a...

Embodiment 3

[0069] The method for transcribing gRNA in vitro and transforming host cells specifically comprises the following steps:

[0070] 1) Construction of gRNA in vitro transcription template.

[0071] Using the method of artificially synthesizing gRNA, and synthesizing the target homologous fragment sequence (the target gene is ura3), select two gRNA sequences at different positions of the ura3 gene, and use the following primers:

[0072] Forward primer Glura-F1 (Seq ID No.10):

[0073] 5' TAATACGACTCACTATA GGAGCAGAAGCCCCCTGCCAGTTTTTAGAGCTAGAAATAGC 3'

[0074] and reverse primer ble-R (Seq ID No.11):

[0075] 5' ACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAG 3'

[0076] The target fragment was amplified, in which the T7 promoter was introduced by the forward primer (the sequence is underlined). After the PCR product was purified and recovered, it was ligated into pMD-18T by TA cloning, transformed into Escherichia coli DH5α, picked the transformant, verified the tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for higher fungi gene disruption includes that a ganoderma lucidum strain capable of stably expressing Cas9 protein by transferring an expression vector containing codon optimized Cas9 gene into haploid ganoderma lucidum (CGMCC NO.5.26); gRNA going through in-vitro transcription is transferred into the ganoderma lucidum expressing the Cas9 protein, a targeted gene is recognized through gRNA, and disruption of specific loci of the targeted gene is realized; endogenous transcription of gRNA is mediated by U6snRNA promoter, and disruption of the specific loci of the targeted gene is realized. Ganoderma lucidum is used as a mode species, the expression vector containing the codon optimized Cas9 gene and a host cell are provided, and an editing method of constructing CRISPR / Cas9 genomethrough two modes of exogenous transcription synthesis of gRNA or endogenous U6small nuclear RNA (U6snRNA) promoter transcription synthesis of gRNA is provided.

Description

technical field [0001] The present invention relates to a technology in the field of genetic engineering, specifically a method of using the principle of CRISPR / Cas9 technology to introduce Cas9 gene and specific gRNA into higher fungal cells so as to realize gene interruption. Background technique [0002] Higher fungi (higher fungi or mushrooms) refer to fungi that can form large fruiting bodies, hyphae contain septa, and can produce conidia during the sexual reproduction stage, including some Ascomycotina (Ascomycotina), Basidiomycotina (Basidiomycotina) and semi Deuteromycotina, common higher fungi include Poria, Tremella, Cordyceps, Hericium, Lentinus edodes, Ganoderma lucidum, etc. Higher fungi are a treasure house of natural products. The fungal polysaccharides, sterols, alkaloids, and terpenes produced by them have biological activities such as improving human immunity, anti-tumor, and antibacterial. Therefore, higher fungi, a class of microorganisms with strong pot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/80C12N15/113C12N15/55C12N1/15
CPCC12N9/22C12N15/113C12N15/80C12N2310/10C12N2800/80
Inventor 肖晗秦浩钟建江
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com