Unlock instant, AI-driven research and patent intelligence for your innovation.

Argonaute-nucleic acid sequence component system used for sequence control, method and composition thereof

A nucleic acid sequence and composition technology, which can be used in biochemical equipment and methods, introduction of foreign genetic material using vectors, analysis of materials, etc., and can solve problems such as reporting of biological functions of HbAgo

Inactive Publication Date: 2018-03-16
PEKING UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, up to now, there is no relevant report on the biological function of HbAgo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Argonaute-nucleic acid sequence component system used for sequence control, method and composition thereof
  • Argonaute-nucleic acid sequence component system used for sequence control, method and composition thereof
  • Argonaute-nucleic acid sequence component system used for sequence control, method and composition thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Codon optimization and total gene synthesis of HbAgo gene sequence

[0049] The GenBank ID of the HbAgo gene: WP_006054116.1, the codon-optimized sequence of Escherichia coli is shown in SEQ ID NO: 1, and the corresponding amino acid sequence is shown in SEQ ID NO: 2.

[0050] 5'-ATGGCGGTGAAAGCGGACATTGAAGATGGTGAAGAGATTGATATTGCGCTCCATGTCACCGGTATTGACGAATGGGAGCACGATGCCATTGCCCGTAAGATCCAGCTTGAAGACGTTGACGGTGCAGCAATTGATCTGACCGTTTTTCACAACAATGATGTGTCTGACTTTGAATGGGAGATTGGTGAATGGTACCTGCTGGAAAACGTGGTTGGCAATGAATTTCGCGGCGAAATGCAGCTGAACCCAGGCTACGATCTCACCGTCACACTGTTAAATGACCCGCCAGCCGCGGCTGGTAACGATAAATCACCCGGGTCCGTACCACCAGAAGAACCTGTAGATCAGTCGGGGGAGAGCGGATCGAGTGGGGCAGCGGCTTCCACGTCAGGCGAGCCTGGAGATGCTGAATTTGTACGCGGTAGCGAAGTGGATGATGGCAGCCGCCCGACTGCTGATGGCGGCGGTAAACTGCTCCACCAGCAGCCTCTGTCGGACGGCAACTATTTATTGCAATTTGAACTGGGGAGTTTACCGGAACTGCCGGTCCATGAATATGAATTACGTGCAACTGGGTCGGGTGGAATTGACCCGGATGACTTTACCAACGGCATTGAGGGGTTCACCGCCAAAGCCGCAAACTATTATCAATCGCGCATTGGTTCACCGGTGACGACTGCGGACGCCAGTCGTCGT...

Embodiment 2

[0053] Expression of embodiment 2HbAgo protein in Escherichia coli

[0054] The HbAgo gene was inserted into the BamHI and NotI restriction sites of the pGEX-6p-1 vector (Biofeng), and a plasmid capable of expressing the fusion protein of the GST tag-HbAgo was constructed. The plasmid was transformed into BL21(DE3)plyss Escherichia coli competent (Beijing Quanshijin Biotechnology Co., Ltd.), and the expression was induced by IPTG at a final concentration of 0.5mM. For protein purification and recovery, refer to the GST-labeled egg purification and recovery manual (GE, 17-0756-01). It was confirmed by protein electrophoresis and N-terminal sequencing that the expressed protein was HbAgo protein (data not provided) with a purity of over 95% and a concentration of 2.5 mg / mL. see results figure 2 .

Embodiment 3

[0055] The in vitro cleavage experiment of embodiment 3HbAgo

[0056] 1. Experimental method

[0057] (1) Reaction system:

[0058] h 2 O:

[0059] 2X RB: 25uL

[0060] DTT(1M):0.1uL

[0061] BSA (10mg / ml): 0.1uL

[0062] HbAgo protein: 5ug

[0063] ssDNA: 300ng

[0064] Plasmid: 400ng

[0065]Make up the total volume to 50 μL with water

[0066] The composition of 2X RB is: 20mM Tris (pH=8.0), 400mM NaCl, 1mM MgCl 2 , 0.8% glycerol, 4mMDTT, 40ug / mL BSA.

[0067] The 5' end phosphorylated ssDNA used in the experiment is:

[0068] nc: 5'-TGGGCTCCTCCTTGTACTCTCTGA (SEQ ID NO: 3)

[0069] F: 5'-GCTGCTGCGAAATTTGAACGCCAG (SEQ ID NO: 4)

[0070] R: 5'-CTGGCGTTCAAATTTCGCAGCAGC (SEQ ID NO: 5)

[0071] The target of the above F or R SSDNA is the sequence in the plasmid pACYCDuet1, the sequence of which is shown in SEQ ID NO: 6:

[0072]

[0073]

[0074]

[0075] (2) First mix HbAgo protein with various DNA nucleic acid strands, centrifuge, and bathe in 55°C wate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to Argonaute-nucleic acid sequence component systems, methods and compositions for sequence manipulation. Specifically, the present invention relates to Argonaute, Argonaute-nucleic acid sequence component composition, Argonaute-nucleic acid sequence component sequence manipulation system capable of cleaving target nucleotide sequences with the help of nucleic acid strands, and the use of said Argonaute, Argonaute-nucleic acid Sequence Component Compositions and Argonaute-Nucleic Acid Sequence Component Sequence Manipulation System Methods for Manipulating Sequences. The Argonaute of the present invention can cut target nucleotide sequences with the help of nucleic acid chains at normal temperature, the cutting efficiency is not lower than 20%, and the optimal salt concentration is 100-200 mmol / L.

Description

technical field [0001] The present invention relates to Argonaute-nucleic acid sequence component systems, methods and compositions for sequence manipulation. Specifically, the present invention relates to Argonaute, Argonaute-nucleic acid sequence component composition, Argonaute-nucleic acid sequence component sequence manipulation system capable of cutting target nucleotide sequences with the help of nucleic acid chains, and the use of said Argonaute, Argonaute-nucleic acid Sequence Component Compositions and Argonaute - Nucleic Acid Sequence Component Sequence Manipulation System Methods for manipulating sequences. Background technique [0002] Argonaute family proteins (Ago) widely exist in animals, plants, bacteria and archaea. The Argonaute (eAgo) protein in animal and plant cells regulates the degradation and translation of intracellular mRNA through the mechanism of single-stranded RNA-mediated RNAi, so as to achieve the purpose of gene expression regulation. Stud...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/11C12N15/63G01N33/573C12Q1/6876A61K38/16A61K31/713
CPCC12N9/22A61K31/713A61K38/00C12N15/111C12N2310/11C12Q1/6876G01N33/573G01N2333/916C12N2320/30
Inventor 席建忠叶延桢王博伦骆宇峰
Owner PEKING UNIV