Unlock instant, AI-driven research and patent intelligence for your innovation.

3, 6-dichloro salicylic acid 5-hydroxylase gene dsmABC and application thereof

A technology of dichlorosalicylic acid and genes, applied in the fields of environmental microorganisms and agriculture, can solve the problems of restricting dicamba's environmental behavior and ecological safety, and the metabolic pathway and its molecular mechanism are unclear

Active Publication Date: 2018-03-23
NANJING AGRICULTURAL UNIVERSITY +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, the metabolic pathway and molecular mechanism of the first demethylation product 3,6-DCSA of microbial degradation of dicamba are still unclear, which seriously restricts the environmental behavior and ecological safety of dicamba. Research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 3, 6-dichloro salicylic acid 5-hydroxylase gene dsmABC and application thereof
  • 3, 6-dichloro salicylic acid 5-hydroxylase gene dsmABC and application thereof
  • 3, 6-dichloro salicylic acid 5-hydroxylase gene dsmABC and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Cloning of embodiment 1.3,6-DCSA hydroxylase gene

[0033] 1.1 Screening of mutant strains

[0034]The research material of this experiment is Rhizorhabdus dicambivorans Ndbn-20 (CCTCC NO:M 2014550), an efficient dicamba-degrading bacterium isolated by members of our laboratory. By subculturing on a fresh 1 / 5LB plate without adding 3,6-DCSA, the bacteria sludge was used for subculture and streaking. After about 25 generations, the bacteria on the plate were washed, and after a certain dilution, spread on 1 / 5LB (1 / 5LB is the most suitable medium for the growth of Ndbn-20), and then use sterilized toothpicks to spot the grown colonies on 1 / 5LB and MSM with 1Mm 3,6-DCSA as the only carbon source On the medium, the strains that can grow on 1 / 5LB but cannot grow on MSM medium are selected, and their ability to degrade 3,6-DCSA is verified. Through the degradation experiment of 3,6-DCSA, a The strain can degrade dicamba to 3,6-DCSA, but the mutant strain that cannot degrad...

Embodiment 2

[0043] Example 2. Functional verification of Cytochrome P450 monooxygenase system dsmABC

[0044] 2.1 Experimental technique

[0045] 2.1.1 PCR amplification of dsmA knockout fragment, dsmA and dsmABC fragment

[0046] With forward primer: 5'- CTTGATATCGAATTCCTGCAG CTGGCCAGCGGCAGTTTCAGCGTTC-3' (SEQ ID NO.7) and reverse primer: 5'- GCTCTAGAACTAGTGGATCC Using CCATGGGAAATCGTCCGCGTTGAGG-3' (SEQ ID NO.8) as a primer, PCR was used to amplify the 561bp homology arm of the dsmA middle region of the monooxygenase gene fragment from Ndbn-20 genomic DNA. Using forward primer: 5'-GGGGTACCCCCCATCCCCGAAAGCCAGTTCTGACAC-3' (SEQ ID NO.9) and reverse primer: 5'-CGGAATTCCGGGGCGTGTTTGATCGACGTAGCAG-3' (SEQ ID NO.10) as primers, amplified from Ndbn-20 genomic DNA by PCR Monooxygenase gene fragment dsmA. With forward primer: 5'-GGGGTACCCCGCTGGGGAAGGTCTTGGTCGCAT-3' (SEQ ID NO.11) and reverse primer: 5'-GCTCTAGAGACCTGGCGTAGCTCATCC-3' (SEQ ID NO.12) as primers, PCR was used to amplify from Ndbn-2...

Embodiment 3

[0081] Example 3. Identification of 3,6-DCSA hydroxylation products

[0082] 3.1 Mass Spectrometric Identification of 3,6-DCSA Hydroxylation Products

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 3, 6-dichloro salicylic acid 5-hydroxylase gene dsmABC and application thereof. A cytochrome P450 monooxygenase system gene dsmABC consists of a cytochrome P450 monooxygenasecomponent gene dsmA shown in SEQ ID No. 1, a ferredoxin gene dsmB shown in SEQ ID No. 3, and a dsmC shown in SEQ ID No. 5. A cytochrome P450 monooxygenase system consists of a cytochrome P450 monooxygenase component DsmA shown in SEQ ID No. 2, a ferredoxin gene DsmB shown in SEQ ID No. 4, and a DsmC shown in SEQ ID No. 6. After the cytochrome P450 hydroxylase three-component gene provided by theinvention is supplemented to a strain which cannot degrade 3,6-DCSA, the stain can obtain a function of degrading the 3,6-DCSA.

Description

technical field [0001] The invention belongs to the fields of environmental microorganisms and agriculture, and relates to 3,6-dichlorosalicylic acid 5-hydroxylase gene dsmABC and its application. Background technique [0002] The development of modern agriculture is inseparable from pesticides. Rational use of pesticides can effectively prevent and control crop diseases and increase crop yields. However, improper use of pesticides will cause environmental damage such as soil and water. The use of herbicides can effectively reduce agricultural labor intensity and ensure normal agricultural production. However, with the extensive use of herbicides, the damage caused by herbicide residues to the soil is becoming more and more serious. According to statistics, the area of ​​farmland affected by herbicides in my country reaches 30 million mu every year, causing losses of several billion yuan every year. Microbial remediation technology is an in-situ bioremediation technology wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N1/21C12N15/82A01H5/00B09C1/10C02F3/34C02F101/36C12R1/01
CPCB09C1/10C02F3/34C02F2101/36C12N9/0008C12N9/0081C12N15/8274C12Y102/07004C12Y114/15006
Inventor 何健李娜姚利丁德荣陶青
Owner NANJING AGRICULTURAL UNIVERSITY