3, 6-dichloro salicylic acid 5-hydroxylase gene dsmABC and application thereof
A technology of dichlorosalicylic acid and genes, applied in the fields of environmental microorganisms and agriculture, can solve the problems of restricting dicamba's environmental behavior and ecological safety, and the metabolic pathway and its molecular mechanism are unclear
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Cloning of embodiment 1.3,6-DCSA hydroxylase gene
[0033] 1.1 Screening of mutant strains
[0034]The research material of this experiment is Rhizorhabdus dicambivorans Ndbn-20 (CCTCC NO:M 2014550), an efficient dicamba-degrading bacterium isolated by members of our laboratory. By subculturing on a fresh 1 / 5LB plate without adding 3,6-DCSA, the bacteria sludge was used for subculture and streaking. After about 25 generations, the bacteria on the plate were washed, and after a certain dilution, spread on 1 / 5LB (1 / 5LB is the most suitable medium for the growth of Ndbn-20), and then use sterilized toothpicks to spot the grown colonies on 1 / 5LB and MSM with 1Mm 3,6-DCSA as the only carbon source On the medium, the strains that can grow on 1 / 5LB but cannot grow on MSM medium are selected, and their ability to degrade 3,6-DCSA is verified. Through the degradation experiment of 3,6-DCSA, a The strain can degrade dicamba to 3,6-DCSA, but the mutant strain that cannot degrad...
Embodiment 2
[0043] Example 2. Functional verification of Cytochrome P450 monooxygenase system dsmABC
[0044] 2.1 Experimental technique
[0045] 2.1.1 PCR amplification of dsmA knockout fragment, dsmA and dsmABC fragment
[0046] With forward primer: 5'- CTTGATATCGAATTCCTGCAG CTGGCCAGCGGCAGTTTCAGCGTTC-3' (SEQ ID NO.7) and reverse primer: 5'- GCTCTAGAACTAGTGGATCC Using CCATGGGAAATCGTCCGCGTTGAGG-3' (SEQ ID NO.8) as a primer, PCR was used to amplify the 561bp homology arm of the dsmA middle region of the monooxygenase gene fragment from Ndbn-20 genomic DNA. Using forward primer: 5'-GGGGTACCCCCCATCCCCGAAAGCCAGTTCTGACAC-3' (SEQ ID NO.9) and reverse primer: 5'-CGGAATTCCGGGGCGTGTTTGATCGACGTAGCAG-3' (SEQ ID NO.10) as primers, amplified from Ndbn-20 genomic DNA by PCR Monooxygenase gene fragment dsmA. With forward primer: 5'-GGGGTACCCCGCTGGGGAAGGTCTTGGTCGCAT-3' (SEQ ID NO.11) and reverse primer: 5'-GCTCTAGAGACCTGGCGTAGCTCATCC-3' (SEQ ID NO.12) as primers, PCR was used to amplify from Ndbn-2...
Embodiment 3
[0081] Example 3. Identification of 3,6-DCSA hydroxylation products
[0082] 3.1 Mass Spectrometric Identification of 3,6-DCSA Hydroxylation Products
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


