Glucose oxidase mutant

A technology of glucose oxidase and mutants, applied in the directions of oxidoreductase, enzymes, biochemical equipment and methods, etc., can solve problems such as the inability to guarantee the stability of enzyme preparations, the uniformity of enzyme preparation distribution, application limitations, and increased equipment investment.

Active Publication Date: 2018-05-04
WEIFANG KANGDIEN BIOTECH +2
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the thermal stability of glucose oxidase derived from Aspergillus niger is relatively poor, and its aqueous solution is incubated at 65°C for 5 minutes, and the remaining enzyme activity is lower than 40%, which limits the application of this enzyme in pellet feed
At present, the method of spraying glucose oxidase liquid onto the feed after feed granulation not only increases equipment investment, but also cannot guarantee the stability of the enzyme preparation and the uniformity of the distribution of the enzyme preparation in the feed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glucose oxidase mutant
  • Glucose oxidase mutant
  • Glucose oxidase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Obtainment of glucose oxidase heat-resistant single point mutant

[0048] 1.1 Amplification of the glucose oxidase gene

[0049] The Aspergillus niger genome was used as a template for PCR amplification, and the PCR primers GOD-F1 and GOD-R1 were as follows:

[0050] GOD-F1: GGTATTGAGGCATCTTTGTTGAC

[0051] GOD-R1: TTATTGCATAGAAGCGTAATC

[0052] The PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5α, and the correct transformant was picked for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Through NCBI BLAST comparison, it was found that the sequence similarity between SEQ ID NO: 1 and the glucose oxidase from Aspergillus niger was as high as 100%, so it was determined that the gene obtained by PCR was the glucose oxidase gene and named GOD.

[0053] 1.2 Amplification and synthesis...

Embodiment 2

[0096] Example 2 Saturation Mutation Screening of Glucose Oxidase Thermostable Single Point Mutants

[0097] Using the method for screening and obtaining heat-resistant mutants described in Example 1, the 64th and 415th amino acids of glucose oxidase GOD were subjected to saturation site mutations. Further, thermostability experiments were carried out on the obtained mutants respectively.

[0098] The results show that when the 64th amino acid of glucose oxidase GOD is mutated from A to L, or K, or M, or F, or N, or Q, they all show better heat resistance than the wild type. The mutants are respectively named GOD3, GOD4, GOD5, GOD6, GOD7, GOD8, and their coding nucleotide sequences are respectively SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10;

[0099] When the 415th amino acid of glucose oxidase GOD is mutated from A to R or N, they all show better heat resistance than the wild type, and the above mutants are named GOD9 and GOD10 respe...

Embodiment 3

[0104] Example 3 Obtainment of Glucose Oxidase Thermostable Two-Point Combination Mutant

[0105] Using the method for screening and obtaining mutants described in Example 1, the mutation combination screening was performed on the 64th and 415th heat-resistant sites of glucose oxidase GOD. Further, thermostability experiments were carried out on the obtained mutants respectively.

[0106] The results show that the two point mutation combinations with better heat resistance than the above single point mutants include: A64R+A415K, or A64R+A415R, or A64R+A415N, or A64L+A415K, or A64L+A415R, or A64L+A415N, Or A64K+A415K, or A64K+A415R, or A64K+A415N, or A64M+A415K, or A64M+A415R, or A64M+A415N, or A64F+A415K, or A64F+A415R, or A64F+A415N, or A64N+A415K, Or A64N+A415R, or A64N+A415N, or A64Q+A415K, or A64Q+A415R, or A64Q+A415N.

[0107] The residual rate of glucose oxidase activity of the two-point mutant is generally increased by 30% to 235% compared with the above-mentioned sin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims to provide a glucose oxidase mutant. The glucose oxidase mutant contains (I) a sequence which is at least 70% homologous with the amino acid sequence, shown as SEQ ID NO:1, of glucose oxidase, as well as (II) a sequence containing at least one immune epitope of the glucose oxidase in (I),and the amino acid sequence of the glucose oxidase is obtained by modification, substitution, deletion or addition of one or more amino acids, and substitution refers to substitution for one or two amino acids. The heat resistance of the single-point mutant of the glucose oxidase is generally higher than that of wild glucose oxidase, the heat resistance of a two-point mutant is further improved as compared with the corresponding single-point mutant, residual enzyme activity after treatment at 60 DEG C for 10 min reaches 71.19%-82.92%, residual enzyme activity after treatment at 65 DEG C for 5 min reaches 63.03%-72.58%, residual enzyme activity after treatment at 70 DEG C for 2.5 minreaches 49.91%-58.96%, and residual enzyme activity after treatment at 75 DEG C for 2.5 min reaches 24.78%-32.05%.

Description

technical field [0001] The invention belongs to the technical field of genetic modification, and in particular relates to a glucose oxidase mutant and application thereof. Background technique [0002] Glucose oxidase is an aerobic dehydrogenase that specifically oxidizes β-D-glucose to generate gluconic acid and hydrogen peroxide. Glucose oxidase usually forms a redox system with catalase, oxidizes β-D-glucose in the presence of molecular oxygen to generate D-gluconolactone, and consumes oxygen to generate hydrogen peroxide. Catalase decomposes hydrogen peroxide to generate water and 1 / 2 oxygen, and then the water combines with gluconolactone to produce gluconic acid. Glucose oxidase shows strong specificity to β-D-glucopyranose. The hydroxyl group on glucose molecule C1 is crucial to the catalytic activity of the enzyme, and the hydroxyl group at the β position is 160 times higher than that at the α position. Glucose oxidase is completely inactive on L-glucose and 2-O-me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53A23K20/189
CPCC12N9/0006C12Y101/03004
Inventor吴秀秀邵弨
OwnerWEIFANG KANGDIEN BIOTECH