Classical swine fever virus (CSFV) real-time fluorescent nucleic acid isothermal amplification detecting kit
A real-time fluorescence, swine fever virus technology, used in the determination/inspection of microorganisms, biochemical equipment and methods, microorganisms, etc., which can solve the problems of false negative detection cost, low sensitivity, and contamination of amplified substances.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0101] Embodiment 1, be used for the design of special primer and probe of real-time fluorescent nucleic acid constant temperature amplification detection classical swine fever virus
[0102] The present invention selects no secondary structure and highly conserved segment in the 5'-UTR of classical swine fever virus as the amplified target sequence region (its nucleotide sequence is shown in sequence 1 in the sequence table), and according to the principle of primer probe design, use DNAStar, DNAMAN software and artificially designed 4 pairs of primers and 1 probe sequence (its nucleotide sequence is as shown in sequence 5 in the sequence listing) for real-time fluorescent nucleic acid constant temperature amplification detection classical swine fever virus (CSFV), obtain as follows Specific sequence:
[0103] Group 1:
[0104] CSFV-nT7-1: AGTAGGACTAGCAAACGGAG
[0105] CSFV-T7-1: AATTTAATACGACTCACTATAGGGAGACGAACTACTGACGACTGT
[0106] CSFV-Probe: CCGACUGGGUGGUCUAAGUGUCGG
...
Embodiment 2
[0120] Embodiment 2, prepare the real-time fluorescent nucleic acid constant temperature amplification detection kit of classical swine fever virus (CSFV)
[0121] Using the special primers and probes provided in Example 1, the real-time fluorescent nucleic acid constant temperature amplification detection kit for CSFV of the present invention was obtained. The kit contains a set of capture probes (TCO, Target Capture Oligo), T7 primers, nT7 primers, CSFV detection probes, internal standard detection probes, internal standards, M-MLV reverse transcriptase and T7 RNA polymerase point.
[0122] The capture probe exists in the nucleic acid extraction solution, the T7 primer, nT7 primer, CSFV detection probe, and internal standard detection probe exist in the CSFV detection solution, and the M-MLV reverse transcriptase and T7 RNA polymerase The enzyme exists in the SAT enzyme solution. Specifically, the kit is divided into A box (specimen processing unit) stored at 2-30°C and B b...
Embodiment 3
[0156] Example 3, in vitro transcription RNA and specific real-time fluorescent nucleic acid constant temperature amplification detection
[0157] Utilize the kit of the present invention (see embodiment 2 for composition) to detect the CSFV RNA transcribed in vitro, and its steps are as follows:
[0158] 1. The in vitro transcribed CSFV RNA was diluted 10 times to obtain 10 copies / ul to 10 5 Copies / ul RNA, repeat 2 tests for each concentration, add 10ul internal standard to each reaction, and add 10ul CSFVRNA of the corresponding concentration at the same time; specifically detect bovine viral diarrhea, sheep border virus and porcine PRRS virus that belong to the same genus as classical swine fever , take 200ul for specific detection.
[0159] 2. Nucleic acid extraction
[0160] 2.1 Add 200 μl of lysate and 200 μl of virus culture to the sample processing tube (1.5mL centrifuge tube) (use physiological saline instead of virus culture when detecting in vitro transcribed RNA)...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



