Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Classical swine fever virus (CSFV) real-time fluorescent nucleic acid isothermal amplification detecting kit

A real-time fluorescence, swine fever virus technology, used in the determination/inspection of microorganisms, biochemical equipment and methods, microorganisms, etc., which can solve the problems of false negative detection cost, low sensitivity, and contamination of amplified substances.

Inactive Publication Date: 2018-07-10
SHANGHAI RENDU BIOTECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to solve the problems that the existing swine fever virus (CSFV) detection method has low sensitivity, long detection period, easy to cause contamination of amplified products, false positive or false negative of experimental results and high detection cost, the present invention provides a A real-time fluorescent nucleic acid constant temperature amplification detection technology for CSFV with short detection cycle, high sensitivity, high specificity, low pollution, stable reaction and low detection cost, easy to popularize and apply, including special primers, probes, and kits and its use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Classical swine fever virus (CSFV) real-time fluorescent nucleic acid isothermal amplification detecting kit
  • Classical swine fever virus (CSFV) real-time fluorescent nucleic acid isothermal amplification detecting kit
  • Classical swine fever virus (CSFV) real-time fluorescent nucleic acid isothermal amplification detecting kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0101] Embodiment 1, be used for the design of special primer and probe of real-time fluorescent nucleic acid constant temperature amplification detection classical swine fever virus

[0102] The present invention selects no secondary structure and highly conserved segment in the 5'-UTR of classical swine fever virus as the amplified target sequence region (its nucleotide sequence is shown in sequence 1 in the sequence table), and according to the principle of primer probe design, use DNAStar, DNAMAN software and artificially designed 4 pairs of primers and 1 probe sequence (its nucleotide sequence is as shown in sequence 5 in the sequence listing) for real-time fluorescent nucleic acid constant temperature amplification detection classical swine fever virus (CSFV), obtain as follows Specific sequence:

[0103] Group 1:

[0104] CSFV-nT7-1: AGTAGGACTAGCAAACGGAG

[0105] CSFV-T7-1: AATTTAATACGACTCACTATAGGGAGACGAACTACTGACGACTGT

[0106] CSFV-Probe: CCGACUGGGUGGUCUAAGUGUCGG

...

Embodiment 2

[0120] Embodiment 2, prepare the real-time fluorescent nucleic acid constant temperature amplification detection kit of classical swine fever virus (CSFV)

[0121] Using the special primers and probes provided in Example 1, the real-time fluorescent nucleic acid constant temperature amplification detection kit for CSFV of the present invention was obtained. The kit contains a set of capture probes (TCO, Target Capture Oligo), T7 primers, nT7 primers, CSFV detection probes, internal standard detection probes, internal standards, M-MLV reverse transcriptase and T7 RNA polymerase point.

[0122] The capture probe exists in the nucleic acid extraction solution, the T7 primer, nT7 primer, CSFV detection probe, and internal standard detection probe exist in the CSFV detection solution, and the M-MLV reverse transcriptase and T7 RNA polymerase The enzyme exists in the SAT enzyme solution. Specifically, the kit is divided into A box (specimen processing unit) stored at 2-30°C and B b...

Embodiment 3

[0156] Example 3, in vitro transcription RNA and specific real-time fluorescent nucleic acid constant temperature amplification detection

[0157] Utilize the kit of the present invention (see embodiment 2 for composition) to detect the CSFV RNA transcribed in vitro, and its steps are as follows:

[0158] 1. The in vitro transcribed CSFV RNA was diluted 10 times to obtain 10 copies / ul to 10 5 Copies / ul RNA, repeat 2 tests for each concentration, add 10ul internal standard to each reaction, and add 10ul CSFVRNA of the corresponding concentration at the same time; specifically detect bovine viral diarrhea, sheep border virus and porcine PRRS virus that belong to the same genus as classical swine fever , take 200ul for specific detection.

[0159] 2. Nucleic acid extraction

[0160] 2.1 Add 200 μl of lysate and 200 μl of virus culture to the sample processing tube (1.5mL centrifuge tube) (use physiological saline instead of virus culture when detecting in vitro transcribed RNA)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a classical swine fever virus (CSFV) real-time fluorescent nucleic acid isothermal amplification detecting kit. The kit comprises a capturing probe, CSFV detecting primers of aT7 primer and a nT7 primer, a CSFV detecting probe, M-MLV reverse transcriptase, T7 RNA polymerase and the like. The kit can detect RNA existing in pig organs, excrement and tissue culture, has the advantages of high specificity, high sensitivity (the kit can reach 100 copies per reaction), low pollution (an amplification product of RNA can be easily degraded in natural environments) and quick detection (detection conventionally needs 50 minutes), can play an important role in healthy breeding of an animal breeding industry and safe meat product monitoring, and has wide application prospects.

Description

technical field [0001] The invention relates to the technical field of biological detection of viruses, in particular to a kit for detecting swine fever virus (CSFV) by using magnetic bead-RNA enrichment technology to extract and purify target RNA and real-time fluorescent nucleic acid constant temperature amplification detection technology. The detection kit of the invention can realize the detection of CSFV nucleic acid in samples such as tissue samples, excrement, tissue culture and the like. Background technique [0002] Swine fever is a highly contagious disease caused by swine fever virus. Pigs are the only natural host of the virus. The excrement and secretions of sick pigs are the main source of infection. Domestic pigs and wild boars of different ages, genders, and varieties are all infected. Susceptible, can occur all year round. Swine fever can cause fever, anorexia, diarrhea, death, etc. in sick pigs, and may have neurological symptoms; sows may abort or give bi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6806C12Q1/6844C12R1/93
CPCC12Q1/6806C12Q1/6844C12Q1/701C12Q2523/308C12Q2521/107C12Q2545/107C12Q2563/107
Inventor 杨胜德孙洁杨俊兴花群义于明辉居金良
Owner SHANGHAI RENDU BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com