Supercharge Your Innovation With Domain-Expert AI Agents!

Srp54k gene, and application of specific dsRNA of srp54k gene to plagiodera versicolora prevention

A gene and blue leaf technology, which is applied in the field of control of willow blue leaf beetle, can solve the problems of unknown target gene and no sequence information, and achieve the effect of low price, environmental friendliness and good application prospect

Inactive Publication Date: 2018-07-13
HUBEI UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, there are few domestic and foreign researches on the function of the gene of the leaf beetle. There is no sequence information, the target gene with insecticidal activity is unknown, and there is no mature RNA interference anti-insect method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Srp54k gene, and application of specific dsRNA of srp54k gene to plagiodera versicolora prevention
  • Srp54k gene, and application of specific dsRNA of srp54k gene to plagiodera versicolora prevention
  • Srp54k gene, and application of specific dsRNA of srp54k gene to plagiodera versicolora prevention

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Acquisition of Leaf Beetle srp54k Gene

[0023] 1. Design of specific primers for the srp54k gene of Leaf beetle

[0024] Upstream primer F: 5'- actatagggaccggcagatctga ATGTGTTCACCTGTGCCTATG-3' (SEQ ID NO: 1);

[0025] Downstream primer R: 5'- ggtaccggggccccccctcgaggtcg AACTGGAAGTCTTGCTTGGTT-3' (SEQ ID NO: 2);

[0026] The underlined part of the sequence represents the homology arm of the plasmid.

[0027] Target fragment (srp54k gene cDNA) sequence (SEQ ID NO: 3):

[0028] ATGTGTTCACCTGTGCCTATGAAAATTATTGGACTACTTGTGGCTGCCACAGCACTGAGGGCCCCACCACCTTTGGCGTGCCCGTCTAACTTTGTTATGATAACAGAACCAACATCGACTTTCCCTTTGAAGGCCTTCGCTTGCGATTCACAAGCTTGACCAATAGTAGCGTCCATAACGAAAATGATATTGTCAGGTTTCACAGCATTCGAAACTGCCAACATCTCTTCGAAAAGAGACTCCTCCTGCTTATGTCTACCACTCGTGTCTACAATGATTATTTCAAAACCTTCTTTCTTGAACATATCCACACCGTCTTGAGCGATAACCACAGGATCCACTTCAGTGTAACTTCCGTAAAACGGTATCCTAGCTTTTGTACAATTTTGTTTCACTTGGTCGTAAGCACCAGCTCTGAATGTGTCAGCACAAACCAAGCAAGACTTCCAGTT

[0029] 2. Acquisition of Leaf Bee...

Embodiment 2

[0082] Example 2 Bacterial vector construction targeting expression of srp54k gene dsRNA

[0083] In this paper, the srp54k gene fragment was cloned into the ampicillin-resistant plasmid L4440 vector containing a bidirectional T7 strong promoter, and introduced into tetracycline-resistant E. coli HT115 as a bacterial expression vector expressing srp54k gene dsRNA, such as figure 1 shown.

[0084] 1. Competent state preparation

[0085] Using CaCl 2 Preparation of Escherichia coli competent cells.

[0086] 2. Connection conversion and verification

[0087] Digest vector L4440 with BglII and SalI (Quick cut) for 3 hours, the system is as follows:

[0088] Table 4 vector L4440 enzyme digestion system

[0089]

[0090] Sample loading, electrophoresis, and target bands were observed in a UV gel imaging system. The recovery of the target fragment is the same as above.

[0091] Ligate the srp54k gene cDNA sequence obtained above with the vector L4440, and introduce it into ...

Embodiment 3

[0101] Example 3 Bacterial Expression Vector Anti-Salox Leaf Beetle Effect Determination

[0102] 1. Effects of dsSrp54k and dsGFP bacterial feeding on Leaf beetle

[0103] The E.coli HT115 expressing the dsRNA targeting the srp54k gene of Leaf beetle was set as the treatment group (dsSrp54k), and the E.coli HT115 expressing the GFP gene dsRNA was set as the control group (dsGFP). Bacteria were cultured overnight and inoculated into a new medium, induced with IPTG after the OD reached 0.4, and continued to culture for 5 hours. Then the bacteria were collected by centrifugation at 5,000rpm, resuspended with 1mL sterile water, and 50μL 2 willow leaves and feed on the willow blue leaf beetle. The larval pupation and eclosion rates were recorded, and the mortality of adults was recorded.

[0104] The mortality rate of adults fed with bacteria expressing dsRNA targeting the srp54k gene was significantly higher than that of the control group (dsGFP) (eg figure 2 , P image 3 , P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a srp54k gene, and application of specific dsRNA of the srp54k gene to plagiodera versicolora prevention. On the basis of a sequence of the plagiodera versicolora srp54k gene, abacterial expression vector capable of expressing and targeting dsRNA of the gene is constructed, and the plagiodera versicolora is killed with poison through bacteria-expressed and bacteria-targetedthe dsRNA of the srp54k gene and spraying bacteria onto leaf surfaces. The dsRNA gene is high in silencing efficiency, has an obvious phenotypic change after being interfered, solves the problem thatthe plagiodera versicolora does not have effective dsRNA of the srp54k gene at present, and has a better application prospect in research and development of novel insecticides.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of srp54k gene and its specific dsRNA in the prevention and treatment of Leaf beetle. Background technique [0002] Plagiodera versicolora Laicharting (Coleoptera, Chromataceae) (Plagiodera versicolora Laicharting) is an important pest in forestry and urban gardens. It mainly harms the leaves and shoots of Salicaceae species such as poplars and willows. Trees cause huge economic losses. At present, the control of this pest is mainly based on chemical pesticides and biological (Bacillus thuringiensis (Bt) preparations and Bt-transformed plants) control, supplemented by physical control. Chemical pesticides have a good control effect on Leaf beetle, but they are not friendly to the environment and may cause human and animal poisoning. Bacillus thuringiensis (Bt) preparations and Bt-transformed plants also show high resistance to Leaf beetle, but Bt biopest...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/113A01N57/16A01P7/04
CPCA01N57/16C12N15/113C12N2310/14
Inventor 张江徐乐天张意秋李凡池罗静马美琪
Owner HUBEI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More