Srp54k gene, and application of specific dsRNA of srp54k gene to plagiodera versicolora prevention
A gene and blue leaf technology, which is applied in the field of control of willow blue leaf beetle, can solve the problems of unknown target gene and no sequence information, and achieve the effect of low price, environmental friendliness and good application prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Acquisition of Leaf Beetle srp54k Gene
[0023] 1. Design of specific primers for the srp54k gene of Leaf beetle
[0024] Upstream primer F: 5'- actatagggaccggcagatctga ATGTGTTCACCTGTGCCTATG-3' (SEQ ID NO: 1);
[0025] Downstream primer R: 5'- ggtaccggggccccccctcgaggtcg AACTGGAAGTCTTGCTTGGTT-3' (SEQ ID NO: 2);
[0026] The underlined part of the sequence represents the homology arm of the plasmid.
[0027] Target fragment (srp54k gene cDNA) sequence (SEQ ID NO: 3):
[0028] ATGTGTTCACCTGTGCCTATGAAAATTATTGGACTACTTGTGGCTGCCACAGCACTGAGGGCCCCACCACCTTTGGCGTGCCCGTCTAACTTTGTTATGATAACAGAACCAACATCGACTTTCCCTTTGAAGGCCTTCGCTTGCGATTCACAAGCTTGACCAATAGTAGCGTCCATAACGAAAATGATATTGTCAGGTTTCACAGCATTCGAAACTGCCAACATCTCTTCGAAAAGAGACTCCTCCTGCTTATGTCTACCACTCGTGTCTACAATGATTATTTCAAAACCTTCTTTCTTGAACATATCCACACCGTCTTGAGCGATAACCACAGGATCCACTTCAGTGTAACTTCCGTAAAACGGTATCCTAGCTTTTGTACAATTTTGTTTCACTTGGTCGTAAGCACCAGCTCTGAATGTGTCAGCACAAACCAAGCAAGACTTCCAGTT
[0029] 2. Acquisition of Leaf Bee...
Embodiment 2
[0082] Example 2 Bacterial vector construction targeting expression of srp54k gene dsRNA
[0083] In this paper, the srp54k gene fragment was cloned into the ampicillin-resistant plasmid L4440 vector containing a bidirectional T7 strong promoter, and introduced into tetracycline-resistant E. coli HT115 as a bacterial expression vector expressing srp54k gene dsRNA, such as figure 1 shown.
[0084] 1. Competent state preparation
[0085] Using CaCl 2 Preparation of Escherichia coli competent cells.
[0086] 2. Connection conversion and verification
[0087] Digest vector L4440 with BglII and SalI (Quick cut) for 3 hours, the system is as follows:
[0088] Table 4 vector L4440 enzyme digestion system
[0089]
[0090] Sample loading, electrophoresis, and target bands were observed in a UV gel imaging system. The recovery of the target fragment is the same as above.
[0091] Ligate the srp54k gene cDNA sequence obtained above with the vector L4440, and introduce it into ...
Embodiment 3
[0101] Example 3 Bacterial Expression Vector Anti-Salox Leaf Beetle Effect Determination
[0102] 1. Effects of dsSrp54k and dsGFP bacterial feeding on Leaf beetle
[0103] The E.coli HT115 expressing the dsRNA targeting the srp54k gene of Leaf beetle was set as the treatment group (dsSrp54k), and the E.coli HT115 expressing the GFP gene dsRNA was set as the control group (dsGFP). Bacteria were cultured overnight and inoculated into a new medium, induced with IPTG after the OD reached 0.4, and continued to culture for 5 hours. Then the bacteria were collected by centrifugation at 5,000rpm, resuspended with 1mL sterile water, and 50μL 2 willow leaves and feed on the willow blue leaf beetle. The larval pupation and eclosion rates were recorded, and the mortality of adults was recorded.
[0104] The mortality rate of adults fed with bacteria expressing dsRNA targeting the srp54k gene was significantly higher than that of the control group (dsGFP) (eg figure 2 , P image 3 , P...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com