Method, primer and kit for detecting SLCO1B1 gene mutation
A technology of kits and sequencing primers, which is applied in the fields of life science and biology, can solve problems such as many operation steps, high price, and specificity impact, and achieve the effects of simple equipment requirements, easy promotion, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Primers for detecting mutations in the SLCO1B1 gene, the primers are designed for exons 5 and 6 of the SLCO1B1 gene, and the primers include:
[0054] A pair of amplification primers targeting exon 5 of the SLCO1B1 gene, the base sequence of which is:
[0055] SLCO1B1-Exon5-F: TGTAAAACGACGGCCAGTTTATCTTTCTTGCTGGACACT
[0056] SLCO1B1-Exon5-R: AACAGCTATGACCATGTAATACAGTCATCCCTTGGTA;
[0057] A pair of amplification primers targeting exon 6 of the SLCO1B1 gene, the base sequence of which is:
[0058] SLCO1B1-Exon6-F: TGTAAAACGACGGCCAGTTTGCTCTTCCTTCATCTTCCG
[0059] SLCO1B1-Exon6-R: AACAGCTATGACCATGTTTCAAAAAGTAGACAAAGGGA.
[0060] In particular, the primers also include a pair of sequencing primers, and the base sequence of the sequencing primers is:
[0061] Sequencing Primer F: TGTAAAACGACGGCCAGT
[0062] Sequencing primer R: AACAGCTATGACCATG.
[0063] A kit for detecting SLCO1B1 gene mutation, comprising:
[0064] (1) detection system PCR reaction solution;
[006...
Embodiment 2
[0077] Example 2 sample DNA amplification
[0078] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):
[0079] (1) Add 20 μl of QIAGEN Protease (or proteinase K) to the bottom of a 1.5ml centrifuge tube.
[0080] (2) Add 200 μl plasma to the centrifuge tube.
[0081] (3) Add 200μl Buffer AL and shake for 15s. (Note: Do not add QIAGEN Protease or Proteinase K directly to Buffer AL. If the sample size is large, increase QIAGEN Protease and Buffer AL proportionally.)
[0082] (4) Water bath at 56°C for 10 minutes, and then briefly centrifuge to remove the liquid on the inner edge of the centrifuge tube cover.
[0083] (5) Add 200 μl of ethanol (96%-100%), shake for 15 s, and centrifuge briefly to remove the liquid along the inner edge of the centrifuge tube cover.
[0084] (6) Carefully add the mixture obtained above (including the precipitate) into the QIAamp Mini spin column (without wetting the rim). Put the spin column into a 2ml collecti...
Embodiment 3
[0089] Example 3 sample DNA amplification
[0090] The blood sample DNA extracted according to Example 2 was then amplified using the amplification primers in Example 1 to amplify Exon 5 and Exon 6 of the SLCO1B1 gene. Amplification was carried out on a conventional PCR instrument, available instruments include ABI veriti (Applied Biosystems, USA) and the like. The details are as follows:
[0091](i) According to the number of samples n (number of samples = number of samples to be tested + 1 negative control + 1 positive control + 1 blank control), configure the PCR amplification reaction solution for the test system, and distribute 19 μL in each tube into reaction tubes;
[0092] (ii) Add 1 μL each of the above-mentioned processed sample to be tested, the negative control substance, and the positive control substance into the reaction tube, mix well, centrifuge at low speed for several seconds, perform PCR amplification, and obtain the amplified product. The preparation met...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com