Low-temperature exoinulinase mutant Mut8S with improved heat stability

A technology of exoinulinase and thermostability, which is applied in the field of genetic engineering, can solve the problems of poor thermostability of low-temperature enzymes, and achieve the effects of improving activity and thermostability

Active Publication Date: 2018-09-07
YUNNAN NORMAL UNIV
View PDF2 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, low-temperature enzymes generally have poor thermostability, and their thermostability needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Low-temperature exoinulinase mutant Mut8S with improved heat stability
  • Low-temperature exoinulinase mutant Mut8S with improved heat stability
  • Low-temperature exoinulinase mutant Mut8S with improved heat stability

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction and Transformation of Wild Enzyme InuAGN25DVS Expression Vector

[0036] 1) According to the exo-inulinase nucleotide sequence JQ863108 (SEQ ID No.4) recorded in GenBank, design primers 5'TGGAAGTTCTGTTCCAGGGGCCCCAGACGGGACAGCATAAACAAG 3' and 5'GGTGGTGGTGTTATCTCTTAAATGCAGAAATACCGAT 3', and use the plasmid pEASY-E1-Z2-5 as a template PCR amplification, the exo-inulinase mature peptide coding sequence Z2-5 was obtained, and the HRV 3C protease cleavage site coding sequence was added at the 5' end of Z2-5, and at the 5' end of Z2-5 and the 3 ' end also formed a recombination region that matched the recombination region at both ends of the linearized vector obtained in (2). Z2-5 can also be obtained by gene synthesis.

[0037]2) Also design primers 5'AGAGATAACACCACCACCACCACCACTG 3' and 5'CCTGGAACAGAACTTCCAGGAATTCGGATCCGCGACC 3', and use the pET-28a(+) plasmid as a template for PCR amplification to obtain a linearized pET-28a(+) vector. The 5' and 3' e...

Embodiment 2

[0042] Construction and Transformation of Embodiment 2 Mutant Enzyme Mut8S Expression Vector

[0043] 1) Synthesize the Mut8S coding gene sequence, add HRV 3C protease restriction site coding sequence and EcoRI restriction enzyme cutting site sequence (5'GAATTCctggaagttctgttccag3') at the 5' end of the coding gene during synthesis, and add the coding sequence at the 3' end of the coding gene The XhoI restriction site sequence (5'CTCGAG 3') was added to the 'end.

[0044] 2) The sequence synthesized in (1) is subjected to EcoRI and XhoI double digestion; at the same time, the expression vector pET-28a(+) is subjected to EcoRI and XhoI double digestion.

[0045] 3) Ligate the digested product in (2) with DNA ligase to obtain the expression vector of the mutant enzyme Mut8S.

[0046] 4) Transform the ligation product into Escherichia coli BL21(DE3) to obtain a recombinant strain containing the gene encoding Mut8S.

Embodiment 3

[0047] Embodiment 3 Preparation of wild enzyme InuAGN25DVS and mutant enzyme Mut8S

[0048] The recombinant strains containing Z2-5 and Mut8S coding genes were respectively inoculated in LB (containing 50 μg mL-1 kanamycin) culture solution at an inoculum amount of 0.1%, and shaken rapidly at 37° C. for 16 hours.

[0049] Then inoculate the activated bacterial solution into fresh LB (containing 50 μg mL-1 kanamycin) culture solution with 1% inoculum, and after rapid shaking culture for about 2–3 hours (OD600 reaches 0.6-1.0), add the final IPTG with a concentration of 0.25mM was used for induction, and the shaking culture was continued at 20°C for about 20h. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the cells with an appropriate amount of McIlvainebuffer with a pH of 7.0, the cells were disrupted ultrasonically in a low-temperature water bath. The crude enzyme solution concentrated in the cells above was centrifuged at 13,000rpm for 10min, the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical fields of genetic engineering and protein modification and particularly relates to a low-temperature exoinulinase mutant Mut8S with the improved heat stability.The amino acid sequence of the mutant Mut8S is represented by SEQ ID NO.1. The optimal pH value of the Mut8S is 6.5; the optimal temperature of the Mut8S is 40 DEG C, and the Mut8S respectively has the enzyme activities of 16%, 27%, 51%, 76% and 78% at the temperatures of 0 DEG C, 10 DEG C, 20 DEG C, 30 DEGC and 50 DEG C; and after being processed at 50 DEG C for 60 minutes, the Mut8S still preserves 100% of the enzyme activity; and the enzyme can be used for hydrolyzing inulin so as to generate fructose. The low-temperature exoinulinase mutant Mut8S with the improved heat stability can be applied to the industries of foods, wine brewing, biological energy sources and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to protein transformation technology, in particular to a low-temperature exo-inulinase mutant Mut8S with improved thermal stability. Background technique [0002] Inulin, also known as inulin, is composed of fructose molecules polymerized through β-2,1 glycosidic bonds, and the end is connected with a molecule of glucose residue. It is widely found in Jerusalem artichoke, burdock, chicory and other plants. Inulinase has two modes of action: one is endo-inulinase, which hydrolyzes the β-2,1 glycosidic bonds inside the inulin polysaccharide chain to generate fructo-oligosaccharides; the other is exo-inulinase, which Hydrolyze β-2,1 glycosidic bonds one by one from the non-reducing end, and finally produce fructose and a small part of glucose. The hydrolyzate of inulin, namely fructose, is widely used in food, medicine, bio-energy and other industries. For example, the sweet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/70
CPCC12N9/2402C12Y302/01007
Inventor周峻沛黄遵锡张蕊何丽梅韩楠玉丁俊美许波唐湘华
OwnerYUNNAN NORMAL UNIV