PSR (Polymerase Spiral Reaction) detection primer for escherichia coli O157:H7, kit and detection method thereof

A detection kit, O157 technology, applied in the biological field, can solve the problems of high reagent price, complex primer design, high false positive rate, etc., and achieve the effect of low detection cost, short time-consuming, simple and fast operation

Pending Publication Date: 2018-11-13
SOUTH CHINA UNIV OF TECH
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the most widely used constant temperature amplification technology-LAMP also has its limitations, such as complex primer design, high false positive rate, high reagent price, and due to the protection of intellectual property rights in Japan, my country has strong limitations in transformation and application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PSR (Polymerase Spiral Reaction) detection primer for escherichia coli O157:H7, kit and detection method thereof
  • PSR (Polymerase Spiral Reaction) detection primer for escherichia coli O157:H7, kit and detection method thereof
  • PSR (Polymerase Spiral Reaction) detection primer for escherichia coli O157:H7, kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1 detects the microbial method of E.coliO157:H7 based on polymerase helical reaction isothermal amplification technology

[0044] 1. The method for detecting pathogenic microorganisms based on polymerase helical isothermal amplification technology. In this embodiment, E.coliO157:H7 is used as an example, and the reagents used are as follows:

[0045] a. Detection primers Ft aqueous solution and Bt aqueous solution, accelerated primer IF and IB aqueous solution with a concentration of 50 μM each, the primer sequences are as follows (5'-3'):

[0046] Detection primer Ft: TTGGCATCGTGTGGACAGGGTAGGACCGCAGAGGAAAGA (SEQ ID NO.1);

[0047] Detection primer Bt: TGGGACAGGTGTGCTACGGTTTCCACGCCAACCAAGATC (SEQ ID NO.2);

[0048] Acceleration primer IF: GTTTCGATGAGTTTATCTGC (SEQ ID NO.3);

[0049] Acceleration primer IB: TCAAAAGCACCCTATAGCTG (SEQ ID NO.4);

[0050] b.2×Reaction stock solution: Tris-HCl with concentration of 40.0mM, ammonium sulfate of 20.0mM, potassium c...

Embodiment 2

[0060] Example 2 Polymerase helical reaction detection E.coli O157:H7 specificity test

[0061] The genomic DNA of Escherichia coli O157:H7ATCC43895 and non-Escherichia coli was established according to the reaction system and conditions in Example 1. The polymerase helical reaction detection method was carried out, and the specificity test was carried out; wherein, the non-Escherichia coli was: Staphylococcus aureus ATCC23235, cheese Lactobacillus GBHM-21 (Bao Zhining. Research on identification, pilot scale preparation and fermentation technology of Lactobacillus casei GBHM-21 [D]. South China University of Technology, 2015.), Salmonella ATCC14028, Pseudomonas aeruginosa ATCC27853, Listeria monocytogenes ATCC19118. Escherichia coli O157:H7 genome is set as a positive control, and ultrapure water is a negative control (the results of the negative control are the same as figure 1 The results of the blank control in A), the results are as follows figure 2 shown. The reactio...

Embodiment 3

[0062] Embodiment 3PSR detects the sensitivity test of E.coli O157:H7

[0063] The genome of Escherichia coli O157:H7 was diluted 10-fold to 112ng / μL, 11.2ng / μL, 1.12ng / μL, 112pg / μL, 11.2pg / μL and 1.12pg / μL, and a negative control ( deionized water), construct the polymerase helical reaction amplification method according to the reaction system in Example 1, to determine the sensitivity of the detection method, the results are as follows image 3 shown. It can be seen from the figure that the reaction system turns green when the concentration of E. coli DNA in the sample is higher than 11.2pg / μL, showing a positive result. The results showed that the established E.coli O157 polymerase helical reaction method could detect 11.2pg / μL of Escherichia coli DNA in the sample.

[0064] Conclusion: From the above experimental results, it can be seen that the polymerase helical reaction amplification method has the following advantages over conventional PCR and fluorescent PCR:

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PSR (Polymerase Spiral Reaction) detection primer for escherichia coli O157:H7, a kit and a detection method thereof. The primer comprises detection primers Ft and Bt, and acceleration primers IF and IB, wherein the nucleotide sequence of the detection primer Ft is shown as SEQ ID NO. 1; the nucleotide sequence of the primer Bt is shown as SEQ ID NO. 2; the nucleotide sequence of the acceleration primer IF is shown as SEQ ID NO. 3; the nucleotide sequence of the acceleration primer IB is shown as SEQ ID NO. 4. The invention further provides a PSR detection kit for theescherichia coli O157:H7. By adopting the PSR detection primer, the kit and the detection method thereof, a detection result can be obtained in about 40 minutes, and meanwhile the detection reliability, specificity and sensitivity can be ensured. The PSR detection primer, the kit and the detection method thereof are particularly suitable for middle-small units and field detection, and are of veryimportant significance to the increase of diagnosis rate of significant group diseases, and early disease diagnosis.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a PSR detection primer for E. coli O157:H7, a kit and a detection method thereof. Background technique [0002] Accurate identification of pathogenic microorganisms is of great significance for food safety accidents caused by foodborne microorganisms and guiding reasonable treatment methods. At present, the detection and identification methods of microorganisms are mainly divided into the following three categories: isolation and culture identification methods, immunological detection and nucleic acid detection. The separation culture identification method is cumbersome to operate, the experiment cycle is long, and the professional level of the experimenters is high. Immunological detection methods require the preparation of expensive monoclonal antibodies, which have high requirements for samples and cannot be detected for complex samples. Nucleic acid detection is mos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/10C12N15/11C12R1/19
CPCC12Q1/6844C12Q1/689
Inventor刘君彦徐振波徐行勇徐瑞瑞刘丽艳苏健裕李冰李琳
OwnerSOUTH CHINA UNIV OF TECH