Method for inserting exogenous fragments into DNA virus genome in efficient, fixed-point and directional manner

A DNA virus and exogenous gene technology, applied in the field of efficient site-directed insertion of exogenous fragments into DNA virus genomes, can solve the problems of low occurrence frequency, large workload and low efficiency of mutants or recombinant viruses, and achieve high fidelity. Effect

Inactive Publication Date: 2018-11-30
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low frequency of homologous recombination, the efficiency of exogenous gene insertion by intracellular homologous recombination is very low, often lower than 0.1%, which will bring considerable problems to the construction of mutants or recombinant viruses. workload and rather long selection cycle
[0003] In the invention patent application with the application number CN201410041906.8 and the publication date of April 30, 2014 entitled "A Specific DNA Virus Genome Modification and Screening Method", a method that can efficiently convert exogenous The site-directed transformation method of gene insertion into the DNA virus genome, which uses the CRISPR-Cas9 system combined with the homologous recombination mechanism, significantly improves the efficiency of inserting foreign genes into the DNA virus genome (up to 8%), but the transformation method still has There is room for improvement, and for large fragments of foreign genes, the insertion efficiency often decreases with the increase of fragment length, so it cannot meet the needs of efficient insertion of foreign genes, especially large fragments of foreign genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inserting exogenous fragments into DNA virus genome in efficient, fixed-point and directional manner
  • Method for inserting exogenous fragments into DNA virus genome in efficient, fixed-point and directional manner
  • Method for inserting exogenous fragments into DNA virus genome in efficient, fixed-point and directional manner

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example as Figure 2-Figure 3 Shown:

[0057] The enhanced green fluorescent protein (EGFP) reporter gene with promoter and transcription termination signal was inserted into the UL23 gene (thymidine kinase, TK) site of the type I herpes simplex virus genome to compare homology based on the CRISPR-Cas9 system The difference between recombination and non-homologous end joining in the integration efficiency of foreign genes:

[0058] 1. Selection of gene loci and construction of plasmids

[0059] (1). The selection of Cas9 protease cleavage site: in HSV1-8F strain (using the strain of type I herpes simplex virus (HSV1) to operate, this strain adopts existing method to separate and preserve, for example, use experiment The HSV1-8F virus subculture strain preserved in the laboratory is used for infection, and 8F is the code name of the virus strain.) In the whole genome sequence, the UL23 gene sequence is found, with NGG (N is any nucleotide sequence, G represents guanine...

Embodiment 2

[0077] Example two such as Figure 4-Figure 8 Shown:

[0078] Using CRISPR / Cas9 technology to insert the firefly luciferin reporter gene with promoter into the UL23 gene (thymidine kinase, ThymidineKinease, TK) site of type I herpes simplex virus genome:

[0079] 1. Selection of gene loci and construction of plasmids

[0080] (1). The selection of Cas9 protease cleavage site: in HSV1-8F strain (using the strain of type I herpes simplex virus (HSV1) to operate, this strain adopts existing method to separate and preserve, for example, use experiment The HSV1-8F virus subculture strain preserved in the laboratory is used for infection, and 8F is the code name of the virus strain.) In the whole genome sequence, the UL23 gene sequence is found, with NGG (N is any nucleotide sequence, G represents guanine) Gene locus, and then find the sequence of 20 bases at the end of the gene locus, which is the gRNA sequence. The sequence selected in this example is GAGGGCGCAACGCCGTACGTCGG;

...

Embodiment 3

[0104] Embodiment three, such as Figure 9-Figure 14 Shown:

[0105] Using CRISPR / Cas9 technology, the enhanced green fluorescent protein (EGFP) was inserted into the C-terminus of the UL23 gene (thymidine kinase, TK) site of the clinically isolated type I herpes simplex virus genome for protein fusion expression:

[0106] 1. Selection of gene loci and construction of plasmids

[0107] (1). Selection of Cas9 protease cleavage site: in the HSV1-ZW6A strain (using the strain of type I herpes simplex virus (HSV1) to infect, this strain can be isolated and preserved by existing methods, for example, clinical isolation The clinical isolate of HSV1-ZW6A virus that was saved later was infected, and ZW6A is the code name of the virus strain.) The UL23 gene sequence was found in the whole genome sequence, with NGG (N is any nucleotide sequence, G represents guanine) The gene locus, and then find the sequence of 20 bases at the fifth end of the gene locus, which is the gRNA sequence. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of virus gene recombination, and particularly relates to a method for inserting exogenous DNA fragments into a specific large DNA virus genome in a fixed-point, directional and efficient manner by utilizing a non-homologous recombination mechanism. The method comprises the following steps of 1) designing and constructing a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9) system for a specific cleavage site of the DNA virus genome; 2) designing and constructing an exogenous gene donor carrying one or more same cleavage sites; 3) introducing an expression vector of the CRISPR-Cas9 system and the exogenous gene donor into a specific cell according to a certain proportion and sequence; 4) aftera period of time, according to virus characteristics, selecting a proper infection time point and multiplicity of infection, and infecting the cell with viruses; 5) selecting an optimized time point to collect progeny recombinant viruses generated after virus infection; and 6) separating, screening and identifying target recombinant progeny DNA viruses. By means of the method, the recombination efficiency of inserting an exogenous gene into the DNA virus genome in a fixed-point and directional manner can be remarkably improved, so that the construction and screening time of the recombinant viruses can be shortened.

Description

technical field [0001] The invention belongs to the technical field of viral genome recombination, especially for double-stranded DNA viruses, and specifically relates to a high-fidelity method that does not rely on homologous recombination to efficiently and directionally insert foreign gene fragments into larger DNA virus genomes, which can be used It is widely used in the study of virus infection mechanism, exogenous gene expression, construction of viral vector, construction of attenuated vaccine and oncolytic virus, etc. Background technique [0002] There are two main methods for constructing recombinant DNA viruses: the first method is to stably preserve the entire DNA virus genome in Escherichia coli in the form of Bacterial Artificial Chromosome (BAC). In vitro, the gene modification operation is carried out by means of endonuclease, homologous recombination modification in Escherichia coli or gene integration system such as Cre-loxP. This recombination method can ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/90C12N9/22C12N15/869
CPCC12N9/22C12N15/102C12N15/86C12N15/907C12N2710/16043
Inventor寸韡宫悦毕研伟李智华李育中张晶晶
OwnerINST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI