Code error-prone DNA (Deoxyribonucleic Acid) polymerase and preparation method thereof

A technology of polymerase and coding, applied in the field of genetic engineering, can solve problems such as optimization and effort

Active Publication Date: 2018-12-07
SHANXI MEDICAL UNIV +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, when using error-prone PCR, it is generally necessary to optimize the mutagenesis conditions for specific genes. There are many conditions that need to be optimized, including Mn 2+ Concentration, Mg 2+ concentration, 4 kinds of dNTP concentration, TaqDNA polymerase concentration, template concentration, extension time, number of cycles, etc., it is still laborious to optimize these conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Code error-prone DNA (Deoxyribonucleic Acid) polymerase and preparation method thereof
  • Code error-prone DNA (Deoxyribonucleic Acid) polymerase and preparation method thereof
  • Code error-prone DNA (Deoxyribonucleic Acid) polymerase and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Sequencing and cloning of the full-length coding region of the gene:

[0025] The total DNA of Rhodococcus R04 was extracted using a commercially available bacterial genomic DNA extraction kit, sequenced by Huada Genomics, and the error-prone DNA polymerase sequence was obtained by blast comparison. As shown in NO: 2, it encodes 1123 nucleotides, with ATG as the start codon and TGA as the stop codon.

[0026] The error-prone DNA polymerase gene was amplified by PCR, and the amplification primers were SEQ ID NO: 3:GCGAATTCATGCAGTCGATCGTGCAGTT, SEQ ID NO: 4AGCGGCCGCGCGAAAGTCGCGTGAT. After the PCR product was detected by 1% agarose gel electrophoresis, it was cut under ultraviolet light containing For the gel block of the target band, use the agarose gel recovery kit to recover the target fragment, and the recovered product and the pET32a plasmid are subjected to EcoRI and NotI double digestion, and then electrophoresis to recover. The error-prone DNA polymeras...

Embodiment 2

[0027] Embodiment 2: Cultivation and induction of recombinant error-prone DNA polymerase strain

[0028] The expression strain was inoculated in 4 mL of LB liquid medium (Amp 100 g / mL) and cultured at 37°C for 16-20 h, then 1.25 mL of the culture solution was inoculated into a 250 mL shake flask, and cultured at 37°C for 4.5 h. Then add IPTG with a final concentration of 0.5mM for induction, and continue to cultivate for 16-20h.

Embodiment 3

[0029] Example 3: Extraction of error-prone DNA polymerase

[0030] Centrifuge at 12000rpm for 10min at 4°C to collect the bacteria, resuspend in 50mL 20mM pH 8.0 phosphate buffer, centrifuge, collect the precipitate, resuspend in 20mL 20mM pH 8.0 phosphate buffer, add 8mg of lysozyme to it to make the final concentration reach 0.4mg / mL. After placing at 37°C for 30 minutes, centrifuge at 10,000 rpm for 20 minutes, and collect the supernatant, which is the error-prone DNA polymerase extract.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and in particular relates to code error-prone DNA (Deoxyribonucleic Acid) polymerase and a preparation method thereof. The preparation method of the code error-prone DNA polymerase comprises the following steps: (1) extracting rhodococcus genome DNA; sequencing and comparing to obtain a code error-prone DNA polymerase gene sequence SEQ ID NO: 1; (2) cloning a nucleotide sequence shown as the SEQ ID NO: 1 so as to obtain a nucleotide segment; (3) connecting the nucleotide segment with a plasmid pET32a, so as to construct a recombinant plasmid; (4) transforming the recombinant plasmid to an escherichia coli competent cell E.coli Bl21, so as to obtain an expression strain; (5) culturing and expressing the strain by utilizingan LB liquid culture medium, and adding IPTG (isopropyl-beta-d-thiogalactoside) with the final concentration of 0.5mM to induce for 16 to 20h; and cracking thalli and purifying to obtain the recombinant error-prone DNA polymerase, wherein an amino acid sequence of the recombinant error-prone DNA polymerase is shown as the SEQ ID NO: 1. By adopting the preparation method, the error-prone DNA polymerase expression and purification efficiency is improved, and the stable and high-activity error-prone DNA polymerase is obtained; and the error-prone effect is improved.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an encoding error-prone DNA polymerase and a preparation method thereof. Background technique [0002] PCR is an in vitro replication technique for DNA fragments, but certain base mismatches often occur, and the general mismatch rate is 10 -6 ~10 -5 . Although base mismatches reduce the fidelity of DNA sequence replication, they provide an exploitable breakthrough for obtaining new DNA sequences. Error-prone PCR is to increase the base mismatch rate of the amplified product by changing the PCR conditions, thereby obtaining a different DNA sequence or gene. Error-prone PCR, as a simple and effective technique to obtain DNA sequence variation, is mainly aimed at specific genes, which has great application prospects in genetic and genetic improvement research. Error-prone PCR technology uses various methods to increase the base mismatch rate of DNA polyme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/70
CPCC12N9/1252C12N15/70C12Y207/07007
Inventor刘承芸杨秀清
OwnerSHANXI MEDICAL UNIV