Pseudo MERS-CoV virus of infected animal, and preparation method and application thereof

A kind of virus and application technology, applied in the fields of genetic engineering, molecular biology, and virology, can solve the problems of lack of and no reported animal models of MERS-CoV

Active Publication Date: 2018-12-21
NAT INST FOR FOOD & DRUG CONTROL
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To date, no animal model of MERS-CoV pseudovirus infection has been reported due to the lack of suitable MERS-CoV pseudoviruses with strong infectivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudo MERS-CoV virus of infected animal, and preparation method and application thereof
  • Pseudo MERS-CoV virus of infected animal, and preparation method and application thereof
  • Pseudo MERS-CoV virus of infected animal, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0160] Example 1. Construction of targeting vector comprising hDPP4 gene

[0161]Human dipeptidyl peptidase 4 (hDPP4) is the receptor of MERS-CoV, which has the ability to mediate the infection of hosts by MERS-CoV. Mouse dipeptidyl peptidase 4 (mDPP4) is not a functional receptor for MERS-CoV, therefore, MERS-CoV cannot infect mice via mDPP4.

[0162] In this example, a targeting vector containing the hDPP4 gene was constructed for knocking the hDPP4 gene into the Rosa26 locus of the mouse genome and expressing the hDPP4 protein, aiming to obtain gene knock-in mice capable of infecting MERS-CoV.

[0163] The targeting vector contains 5' homology arm, splicing acceptor (splicing acceptor, SA), hDPP4 gene, internal ribosome entry site (IRES) sequence, tdTomato reporter gene, woodchuck hepatitis virus post-transcriptional regulatory element (woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)), poly A sequence, 3' homology arm; wherein said 5' homology arm a...

Embodiment 2

[0167] Example 2. Generation of mice with targeted knock-in of the hDPP4 gene at the target site of the Rosa26 locus

[0168] The targeting vector comprising the hDPP4 gene constructed in Example 1, the sgRNA efficiently targeting the Rosa26 locus (comprising the nucleotide sequence TAGGCCGCACCCTTCTCCGG shown in SEQ ID NO: 2 and the nucleotide sequence AAACCCGGAGAAGGGTGCGG shown in SEQ ID NO: 3 ) and Cas9 mRNA sequences known in the prior art (for example, the Cas9 mRNA sequence encoding the amino acid sequence shown in SEQ ID NO: 6) were microinjected into 294 C57BL / 6 mouse zygotes, and then the zygotes were implanted into pseudopregnant The surrogate mice were pregnant in KM mice or ICR mice, and the offspring were produced by the surrogate mice. A total of 41 offspring were obtained.

[0169] For 41 offspring of surrogate mice, the primer hDpp4 forward primer: 5'-CTGCAGTACCCAAAGACTGTACGGG-3' (SEQ ID NO: 4); hDpp4 reverse primer: 5'-GACACCTTTTCCGGATTCAGCTCACA-3' (SEQ ID NO:...

Embodiment 3

[0172] Example 3. Detection of hDPP4 gene expression and immune system detection in R26-hDPP4 mice

[0173] The expression of hDPP4mRNA in R26-hDPP4 mice was detected by reverse transcription polymerase chain reaction (RT-PCR). figure 1 D shows that significant expression of hDPP4 mRNA can be detected in lung, brain, heart, liver, kidney, and intestine. Western blotting of lung and brain tissues confirmed the expression of hDPP4 protein ( figure 1 E). The R26-hDPP4 mice of the present invention have the highest expression of hDPP4 in the lung. Benefiting from the tdTomato gene inserted after the hDPP4 gene, the expression pattern of hDPP4 in mouse tissue and whole body was visualized by bioluminescent imaging (BLI) ( figure 1 F).

[0174] The expressions of IL-12, TNF-α, INF-γ, MCP-1, IL-10 and IL-6 in R26-hDPP4 mice were detected by flow cytometry and the corresponding cytokines in wild-type C57BL / 6 mice expression was comparable, suggesting that insertion of human DPP4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a pseudo MERS-CoV virus packaging system, a method for preparing pseudo MERS-CoV viruses by in-vitro transfection of cells using the pseudo MERS-CoV virus packaging system, and a mouse model with knock-in of a hDPP4 (human dipeptidyl peptidase 4) gene infected by the pseudo MERS-CoV viruses in a biological laboratory lack of BSL-3 (biological safety level 3), so as to evaluate the in-vivo effects of an anti-virus agent and a vaccine.

Description

Technical field: [0001] The invention relates to the fields of virology, genetic engineering and molecular biology. Specifically, the present invention relates to a pseudotyped MERS-CoV virus packaging system, a method for transfecting cells in vitro using the pseudotyped MERS-CoV virus packaging system to prepare a pseudotyped MERS-CoV virus, and involves The in vivo efficacy of antiviral agents and vaccines was assessed using the pseudotyped MERS-CoV virus to infect a human dipeptidyl peptidase 4 (hDPP4) knock-in mouse model in the biological laboratory at the (BSL-3) facility . Background technique [0002] Most coronaviruses that infect humans cause mild upper respiratory disease, however, a novel betacoronavirus associated with severe respiratory disease in humans emerged in the Middle East in June 2012—Middle East Respiratory Syndrome Coronavirus (MERS-CoV). Respiratory syndrome coronavirus (MERS-CoV)) (Zaki AM et al., Isolation of a novel coronavirus from a man with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/86C12Q1/70C12Q1/686G01N33/569A01K67/027
CPCA01K67/0278G01N33/56983C12N15/86C12Q1/686C12Q1/701A01K2267/0337A01K2227/105C12N2770/20043Y02A50/30
Inventor 黄维金刘强王佑春范昌发李倩倩吴曦刘甦苏吕建军杨艳伟曹愿
Owner NAT INST FOR FOOD & DRUG CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap