Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Production method of recombinant strain expressing ETX-CSA at same time and vaccine related to recombinant strain

A technology of recombinant bacteria and vaccines, applied in the direction of microorganism-based methods, biochemical equipment and methods, vaccines, etc., can solve the problems of vaccine production waste, unqualified potency of Clostridium putrefaction components, and many manpower

Pending Publication Date: 2019-01-01
CHINA INST OF VETERINARY DRUG CONTROL
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the vaccines currently on the market generally use the enzymatic digestion solution of beef and liver as raw materials to prepare the medium. The preparation process of the medium prepared by this method is cumbersome, time-consuming, and requires a lot of manpower. Uneven quality leads to unstable toxin production performance, which affects the quality of the vaccine, and also brings great waste and high cost to vaccine production
Moreover, among the 33 batches of products that were unqualified by the serum neutralization method between 2006 and 2015, 15 batches of products were unqualified for the potency of Clostridium putrefaction components, and 21 batches of products were of type C The potency of Clostridium perfringens components is unqualified, and the potency of Clostridium perfringens type D components in 13 batches of products is unqualified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production method of recombinant strain expressing ETX-CSA at same time and vaccine related to recombinant strain
  • Production method of recombinant strain expressing ETX-CSA at same time and vaccine related to recombinant strain
  • Production method of recombinant strain expressing ETX-CSA at same time and vaccine related to recombinant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Embodiment 1, the construction of the recombinant Escherichia coli BL21-pET-EA expressing ETX-CSA simultaneously

[0098] 1. Design primers

[0099] According to the nucleotide sequences of Clostridium perfringens epsilon toxin and Clostridium putrefaction α toxin published on NCBI, primers were designed respectively, and a linker was added. The linker sequence was "GGTGGCGGGGGTAGCGGCGGTGGCGGTTCTGGTGGCGGTGGCTCC". The designed primers are shown in Table 3.

[0100] Table 3 Target fragment amplification and plasmid construction primer list

[0101]

[0102]

[0103] 2. Amplification of the target fragment

[0104] 1. Separate amplification of two target fragments

[0105] The PCR reaction system is shown in Table 4.

[0106] Table 4 PCR reaction system 1

[0107] total capacity

50μl

2×A8 FastHiFi PCR MasterMix

25μl

Type D Clostridium perfringens C60-3 genome or Clostridium putrefaction C55-1 genome

1μl

F_32acpe (for am...

Embodiment 2

[0127] Example 2, Induced expression and high-density fermentation of recombinant Escherichia coli BL21-pET-EA containing recombinant plasmid pET-EA

[0128] The solvent of MDG non-inducing medium is water; the solute and concentration are: 25mM Na 2 HPO 4 , 25mM KH 2 PO 4 , 50mMNH 4 Cl, 5mM Na 2 SO 4 , 2mM MgSO 4 , 5g / L glucose, 2.5g / L aspartic acid, ampicillin 100μg / mL, pH is 7.4. The medium formula comes from this article, F William Studier.Stable Expression Clones and Auto-Induction for Protein Production in E.coli[J].Methods in Molecular Biology,2014,1091:1-17.

[0129] The solvent of ZYM-5052 self-induction medium is water; the solute and concentration are: 10g / L casein peptone, 5g / L yeast extract, 25mM Na 2 HPO 4 , 25mM KH 2 PO 4 , 50mM NH 4 Cl, 5mM Na 2 SO 4 , 2mM MgSO 4 , 5g / L glycerol, 0.5g / L glucose, 2g / L α-lactose, ampicillin 100μg / mL, pH 7.4. The medium formula comes from this article, FWilliam Studier.Stable Expression Clones and Auto-Induction fo...

Embodiment 3

[0140] Example 3, the immune effect of the vaccine made by the high-density fermentation of recombinant Escherichia coli BL21-pET-EA on animals

[0141] 1. Seedling making

[0142] Take the bioreactor culture obtained in Example 2, add formaldehyde solution (containing 40% formaldehyde, % represents mass fraction) amount according to 0.4% of the total volume, and inactivate at 37° C. for 48 hours. After passing the inactivation and detoxification test, prepare the vaccine with the antigen (bioreactor culture after the above-mentioned inactivation): aluminum glue (product of SPI Pharma company, item number is VAC 20HA) ratio is 4:1 (volume ratio), so that The final concentration of the target protein (fusion protein shown in SEQ ID No.1) in the obtained vaccine was 300 μg / mL.

[0143] 2. The immune effect of the vaccine on rabbits

[0144] Before immunization, 5 mL of blood was collected from the middle artery of the ear of each rabbit, and the serum was separated, and the ne...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a production method of a recombinant strain expressing ETX-CSA at the same time and a vaccine related to the recombinant strain. A construction method of the recombinant straincomprises the following steps of introducing encoding gene of a fusion protein ETX-CSA into escherichia coli to obtain the recombinant strain expressing the fusion protein, wherein an amino acid sequence of linking peptide is 297th-311st sites of SEQ ID No.1. According to the method provided by the invention, two kinds of toxin proteins can be acquired at the same time by fermenting one strain only, and the strain can prevent two diseases after being prepared into a vaccine; after the strain and a C type clostridium perfringens toxin are prepared into a combined vaccine, the combined vaccinecan generate excellent immune effect, and titers of rabbit serums in three components (S, C, D) can be increased to 3, 4 and 10 times of a norm standard respectively. The method provided by the invention is good in stability, short in consumed time and low in cost, wherein the costs of the S component and the D component are lowered to be 1 / 100 of the traditional technology, and the titer cost ofthe three components (S, C, D) can be increased to be 344, 4 and 993 times of a traditional technology respectively.

Description

technical field [0001] The invention belongs to the field of veterinary biological products, and in particular relates to a production method of a recombinant bacterium simultaneously expressing ETX (clostridium perfringens epsilon toxin)-CSA (clostridium putrefaction alpha toxin) and related vaccines. Background technique [0002] Sheep rapid disease, sudden attack, lamb dysentery and enterotoxemia are caused by Clostridium putrefaciens, Clostridium perfringens type C, Clostridium perfringens type B and Clostridium perfringens type D respectively. Common multiple infectious diseases (Lu Chengping. Veterinary Microbiology [M]. Beijing: China Agricultural Press, 2013:192-202.), they often co-occur, the course of the disease is sharp, and the affected animals often die without showing symptoms. High and dangerous. Immunization is therefore the only effective way to control these diseases. Animal husbandry developed countries such as Europe, America and Australia all regard t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/62C12N1/21C07K19/00C12P21/02A61K39/08A61P31/04C12R1/19
CPCA61K39/08A61K2039/521A61K2039/523A61K2039/552A61K2039/55505A61P31/04C07K14/33C07K2319/00C07K2319/55C12N15/62C12N15/70
Inventor 彭小兵蒋玉文杜吉革李旭妮彭国瑞
Owner CHINA INST OF VETERINARY DRUG CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com