Production method of recombinant strain expressing ETX-CSA at same time and vaccine related to recombinant strain
A technology of recombinant bacteria and vaccines, applied in the direction of microorganism-based methods, biochemical equipment and methods, vaccines, etc., can solve the problems of vaccine production waste, unqualified potency of Clostridium putrefaction components, and many manpower
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0097] Embodiment 1, the construction of the recombinant Escherichia coli BL21-pET-EA expressing ETX-CSA simultaneously
[0098] 1. Design primers
[0099] According to the nucleotide sequences of Clostridium perfringens epsilon toxin and Clostridium putrefaction α toxin published on NCBI, primers were designed respectively, and a linker was added. The linker sequence was "GGTGGCGGGGGTAGCGGCGGTGGCGGTTCTGGTGGCGGTGGCTCC". The designed primers are shown in Table 3.
[0100] Table 3 Target fragment amplification and plasmid construction primer list
[0101]
[0102]
[0103] 2. Amplification of the target fragment
[0104] 1. Separate amplification of two target fragments
[0105] The PCR reaction system is shown in Table 4.
[0106] Table 4 PCR reaction system 1
[0107] total capacity
50μl
2×A8 FastHiFi PCR MasterMix
25μl
Type D Clostridium perfringens C60-3 genome or Clostridium putrefaction C55-1 genome
1μl
F_32acpe (for am...
Embodiment 2
[0127] Example 2, Induced expression and high-density fermentation of recombinant Escherichia coli BL21-pET-EA containing recombinant plasmid pET-EA
[0128] The solvent of MDG non-inducing medium is water; the solute and concentration are: 25mM Na 2 HPO 4 , 25mM KH 2 PO 4 , 50mMNH 4 Cl, 5mM Na 2 SO 4 , 2mM MgSO 4 , 5g / L glucose, 2.5g / L aspartic acid, ampicillin 100μg / mL, pH is 7.4. The medium formula comes from this article, F William Studier.Stable Expression Clones and Auto-Induction for Protein Production in E.coli[J].Methods in Molecular Biology,2014,1091:1-17.
[0129] The solvent of ZYM-5052 self-induction medium is water; the solute and concentration are: 10g / L casein peptone, 5g / L yeast extract, 25mM Na 2 HPO 4 , 25mM KH 2 PO 4 , 50mM NH 4 Cl, 5mM Na 2 SO 4 , 2mM MgSO 4 , 5g / L glycerol, 0.5g / L glucose, 2g / L α-lactose, ampicillin 100μg / mL, pH 7.4. The medium formula comes from this article, FWilliam Studier.Stable Expression Clones and Auto-Induction fo...
Embodiment 3
[0140] Example 3, the immune effect of the vaccine made by the high-density fermentation of recombinant Escherichia coli BL21-pET-EA on animals
[0141] 1. Seedling making
[0142] Take the bioreactor culture obtained in Example 2, add formaldehyde solution (containing 40% formaldehyde, % represents mass fraction) amount according to 0.4% of the total volume, and inactivate at 37° C. for 48 hours. After passing the inactivation and detoxification test, prepare the vaccine with the antigen (bioreactor culture after the above-mentioned inactivation): aluminum glue (product of SPI Pharma company, item number is VAC 20HA) ratio is 4:1 (volume ratio), so that The final concentration of the target protein (fusion protein shown in SEQ ID No.1) in the obtained vaccine was 300 μg / mL.
[0143] 2. The immune effect of the vaccine on rabbits
[0144] Before immunization, 5 mL of blood was collected from the middle artery of the ear of each rabbit, and the serum was separated, and the ne...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com