Method for locating damage and modification sites on genomic DNA

A genome and locus technology, applied in the fields of molecular biology and biomedicine, can solve the problems of high experimental cost, low accuracy and low resolution, and achieve the effects of high resolution, high accuracy and easy operation.

Active Publication Date: 2019-01-25
中磷科技深圳有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the problems of high experimental cost, low accuracy, high background, and low resolution in the prior art, the present invention provides a method for precisely locating damage and mod...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for locating damage and modification sites on genomic DNA
  • Method for locating damage and modification sites on genomic DNA
  • Method for locating damage and modification sites on genomic DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Location of short-strand DNA breakage sites

[0030] 1. Synthesize a DNA double-stranded fragment containing 100 bp by a DNA synthesis company (IDT, USA). The sense strand sequence is:

[0031] ACTGGGGCCAGATG CGTAAGC CCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAG, the subscript is DNA single-strand endonuclease Nb.BsrDI site;

[0032] 2. Single-stranded enzyme-cut DNA fragments: 50 μL reaction system contains: 10 units of single-stranded endonuclease Nb.BsrDI (NEB, USA), 5 μL buffer (NEB cutsmart buffer), 1 μg DNA low-quality substance, and water to make up 50 μL. After reacting at 65°C for 1 hour, inactivate at 80°C for 20 minutes;

[0033] 3. Breakpoint labeling: Add 2 μL of thio-modified nucleotides (10 mM, Trilink), 1 μL of DNA polymerase I to the reaction solution, react at 15 °C for 1 hour, and stop the reaction at 65 °C for 10 min;

[0034] 4. Template elimination: add 10 units of exonuclease III (NEB) and 10 units o...

Embodiment 2

[0037] Example 2 Location of short-strand DNA damage (Uracil) site

[0038] 1. Synthesize a DNA double-stranded fragment containing 100 bp by a DNA synthesis company (IDT, USA). The sense strand sequence is:

[0039] ACTGGGGCCAGATG U GTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAG, the subscript is DNA damage (Uracil) site;

[0040] 2. Enzyme cutting DNA damage site: 50 μL reaction system contains: 10 units of Uracil repair enzyme UDG and endonuclease IV (NEB, USA), 5 μL buffer (NEB cutsmart buffer), 1 μg DNA low content, make up 50 μL with water. After reacting at 37°C for 1 hour, inactivate at 75°C for 20 minutes;

[0041] 3. Breakpoint labeling: Add 2 μL of thio-modified nucleotides (10 mM, Trilink), 1 μL of DNA polymerase I to the reaction solution, react at 15 °C for 1 hour, and stop the reaction at 65 °C for 10 min;

[0042] 4. Template elimination: add 10 units of exonuclease III (NEB) and 10 units of exonuclease RecJ (NEB) to th...

Embodiment 3

[0045] Example 3 Locating Genomic DNA Fracture Sites

[0046] 1. Cultivate E. coli DH10B strain overnight at 37°C in 10 mL of LB medium. Collect 1mL of bacteria, and use OMEGAbacterial DNA extraction kit (OMEGA Company, USA) to extract genomic DNA, and the method is carried out according to the product instructions;

[0047] 2. Enzyme cutting DNA fragmentation site: 50 μL reaction system contains: 10 units of DNA single-strand nicking enzyme Nb.BsrDI (NEB, USA), 5 μL buffer (NEB cutsmart buffer), 1 μg genomic DNA low content, make up 50 μL with water . After reacting at 37°C for 1 hour, inactivate at 75°C for 20 minutes;

[0048] 3. Breakpoint labeling: Add 2 μL of thio-modified nucleotides (10 mM, Trilink) and 1 μL of DNA polymerase I to the reaction mixture, react at 15°C for 1 hour, and stop the reaction at 65°C for 10 minutes.

[0049] 4. Template elimination: add 10 units of exonuclease III (NEB) and 10 units of exonuclease RecJ (NEB) to the reaction solution, and reac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for locating damage and modification sites on genomic DNA. Firstly, a damage or modification site of a DNA sample is converted into a breakpoint. Then thionucleotide and DNA polymerase I were added for incision translation. The sample obtained after the reaction is terminated is added with a nuclease digestion template sensitive to phosphorothioylation modificationDNA. Finally, the phosphorothioyl modified DNA was sequenced, and the 5'end of the obtained sequence was the original damaged or modified site. The method provided by the invention, the invention fills in the blank that the existing technology at home and abroad can not accurately locate the damage site on the genomic DNA, and can realize the quantitative and positioning analysis of the damage andmodification sites of DNA samples with different lengths and different sources. The invention is simple to use, easy to operate, and has no special requirements on the samples, high accuracy, low detection background influence and high resolution.

Description

technical field [0001] The invention belongs to the fields of molecular biology and biomedicine, and specifically relates to a method for precisely locating damage and modification sites on genome DNA. Background technique [0002] As the carrier of the genetic information of organisms, DNA molecules are the material basis for cell reproduction and normal physiological functions. However, a variety of factors in the external environment and within the organism can cause damage or changes to DNA molecules, such as ultraviolet rays, radiation, carcinogenic chemicals, and oxidative stress generated during the cell's own metabolism. If DNA damage or changes in genetic information cannot be repaired in time, it may affect the normal physiological or genetic functions of cells, such as cell canceration and genetic diseases. Therefore, organisms, especially higher organisms, have evolved a complex and complete DNA repair system, that is, DNA molecules in organisms are always in a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6869
CPCC12Q1/6869C12Q2521/327C12Q2521/319C12Q2535/122C12Q2525/117
Inventor 曹博
Owner 中磷科技深圳有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap