Method for rapidly creating engineering female sterile line suitable for mechanized seed production by using genome editing technology

A genome editing and female technology, which is applied in the field of plant molecular biology and agricultural biology, can solve the problems of backward pollination technology, the need for staged insertion of sterile lines and restorer lines, and the difficulty of effective sorting of self-bred seeds. Effects of biological safety, reduction of seed production operation procedures, and convenience of mechanized operation

Inactive Publication Date: 2019-03-19
HUNAN HYBRID RICE RES CENT
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The main problems of mechanized seed production are that the sterile lines and restorer lines need to be planted in stages, the pollination technology is backward, and the self-bred seeds of hybrid seeds and restorer lines are difficult to effectively sort, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly creating engineering female sterile line suitable for mechanized seed production by using genome editing technology
  • Method for rapidly creating engineering female sterile line suitable for mechanized seed production by using genome editing technology
  • Method for rapidly creating engineering female sterile line suitable for mechanized seed production by using genome editing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. Using Genome Editing Technology to Rapidly Obtain Female Sterile Materials

[0040] 1. Using CRISPR / Cas9 technology to edit rice wild-type PTB1 gene.

[0041] 1. Target gene target site selection and double-stranded linker design

[0042] Find the position of any NGG (PAM) in the mutation region of the target gene, and the 20th upstream base is the sequence of A (using U3 promoter) or G (using U6a~c promoter) (A, G are U3 and U6 promoters respectively The transcription initiation base of the subunit) is preferably selected as the target sequence. Target specificity checks were performed on MBKbase and RIGWR with the R498 and 9311 genomes respectively, and 2 targets were designed:

[0043] Target 1: acccgaggaaggacaaaaatggg (SEQ ID NO. 2)

[0044] Target 2: ggactgtgataggaacattgtgg (SEQ ID NO. 3)

[0045] Synthesize two primers PTB-B2 primer and PTB-AU2 carrying adapters according to the sequence of the target site (the adapter sequence is complementary to t...

Embodiment 2

[0076] Example 2 Application of female sterile material to mechanized seed production of hybrid rice

[0077] 1. Transferring three gene-linked expression cassettes of female fertility gene, pollen lethal gene and fluorescent selection marker gene into rice

[0078] 1. Construction of concatenated expression vectors

[0079]On the expression vector pCAMBIA1300, three expression cassettes were inserted; the wild-type PTB1 expression cassette, the pollen lethal amylase gene ZM-AA1 expression cassette, and the fluorescent screening marker gene RFP expression cassette. Wild-type PTB1 carries its own promoter and terminator; the amylase gene ZM-AA1 expression box elements include: maize pollen development late specific promoter PG47, maize transit peptide ZM-BT1, maize amylase gene coding sequence ZM-AA1, maize terminator IN2-1; red fluorescent protein gene RP expression cassette elements include: maize seed-specific promoter END2, RP coding sequence on vector pLj02, and potato te...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for rapidly creating an engineering female sterile line suitable for mechanized seed production by using a genome editing technology. The method comprises the followingthree steps: (1) acquiring a female sterile mutant by virtue of a mutagenesis technology or a gene editing technology; (2) transferring an expression vector carrying three expression cassettes such as female fertile genes, pollen lethal genes and selective marker genes into a receptor material by virtue of a transgenic technology to obtain a transgenic material; and (3) breeding the engineering female sterile line suitable for the mechanized seed production by hybridizing and polymerizing the female sterile mutant and the transgenic material. By adopting the method, an excellent restoration line with same initial planting period of the sterile line can be rapidly converted to the engineering female sterile restoration line suitable for the mechanized seed production. The method is wide inapplication and market prospect in the field of agriculture.

Description

technical field [0001] The invention belongs to the fields of plant molecular biology and agricultural biotechnology, and in particular relates to a method for quickly creating an engineering female sterile line suitable for mechanized seed production by using genome editing technology. Background technique [0002] Rice is the most important food crop in my country, and the planting area of ​​hybrid rice accounts for more than 57% of the total area of ​​rice, with an average yield of 7.2t / hm 2 , which is 1.4t higher than that of conventional rice, and the increased grain produced by planting hybrid rice every year can feed 70 million more people. The success of hybrid rice research has enabled China to feed 22% of the world's population with 7% of the world's land. In the production of hybrid rice, sowing (transplanting) and harvesting can be mechanized. However, another important link in the hybrid rice industry—seed production, mostly continues the traditional production...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N5/10A01H5/00A01H6/46
CPCC07K14/415C12N15/829
Inventor曹孟良夏玉梅唐宁李丁罗珊卜小兰余木兰
OwnerHUNAN HYBRID RICE RES CENT