Aldehyde dehydrogenase and its gene, construction of recombinant bacteria and its application in the synthesis of furan carboxylic acid

An aldehyde dehydrogenase and furan carboxylic acid technology, which is applied in the fields of genetic engineering technology and biocatalysis, can solve the problems of reduced conversion efficiency, prolonged reaction time and the like, and achieves the effects of simple production process, high production efficiency and mild production conditions

Active Publication Date: 2022-04-22
SOUTH CHINA UNIV OF TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, with the increase of the substrate concentration, the reaction time gradually prolongs and the conversion efficiency gradually decreases.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aldehyde dehydrogenase and its gene, construction of recombinant bacteria and its application in the synthesis of furan carboxylic acid
  • Aldehyde dehydrogenase and its gene, construction of recombinant bacteria and its application in the synthesis of furan carboxylic acid
  • Aldehyde dehydrogenase and its gene, construction of recombinant bacteria and its application in the synthesis of furan carboxylic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Mining of Aldehyde Dehydrogenase Encoding Genes

[0044] In order to excavate the key enzyme in the genome of Comamonas testosteroni SC1588 that can catalyze the oxidation of bio-based furan to furan carboxylic acid, Shenzhen Huada Gene Technology Service Co., Ltd. was entrusted to sequence the draft genome of Comamonas testosteroni SC1588, according to According to the functional annotation of the predicted coding sequence, five aldehyde dehydrogenase genes were mined from the genome, namely, CtCALDH1 gene, CtCALDH2 gene, CtVDH1 gene, CtVDH2 gene and CtSAPDH gene.

Embodiment 2

[0046] Construction of recombinant bacteria

[0047] (1) Using Comamonas testosteroni SC1588 genomic DNA as a template, the full-length sequences of CtCALDH1, CtCALDH2, CtVDH1, CtVDH2 and CtSAPDH genes were amplified by designing specific primers;

[0048] (2) connecting the aldehyde dehydrogenase gene to the expression vector pET-28a to obtain a recombinant plasmid;

[0049] (3) Transform the recombinant plasmid verified by sequencing into the expression host E.coli BL21(DE3), and obtain recombinant bacteria E.coli BL21(DE3)_CtCALDH1, E.coli BL21(DE3)_CtCALDH2, E.coli BL21(DE3)_CtCALDH2, E. .coli BL21(DE3)_CtVDH1, E.coli BL21(DE3)_CtVDH2 and E.coli BL21(DE3)_CtSAPDH.

[0050] Table 1 Primer Information

[0051] Primer name Primer sequence (5'-3') CtCALDH1 upstream primer CAGGATCCATGACCCAGACGAATTCGTCCATC CtCALDH1 downstream primer ATGAAGCTTGGGAGTGACTGCGGCCTGCA CtCALDH2 upstream primer CGGGATCCATGAACTACATGGACTTGCACCGCA CtCALDH2 downstream...

Embodiment 3

[0053] Inducible expression of aldehyde dehydrogenase

[0054] Inoculate the recombinant bacteria obtained in Example 2 into 30 mL of LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, pH 7.2) containing 50 μg / mL kanamycin , cultivated at 37°C and 180rpm for 12h. Then, transfer 1% of the inoculum to 100 mL LB medium containing 50 μg / mL kanamycin, and culture at 37° C. and 180 rpm. OD of bacterial solution 600 When it reached 0.6-0.8, IPTG was added to make the final concentration 0.1 mM, and placed at 18° C. and 160 rpm for 20 h of induction culture. After the cultivation, the bacterial cells were collected by centrifugation at 8000 rpm and 4° C. for 5 min, and the cells were washed twice with 0.85% physiological saline.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the fields of genetic engineering technology and biocatalysis, and discloses aldehyde dehydrogenase and its gene, construction of recombinant bacteria and its application in furan carboxylic acid synthesis. The present invention screens out five aldehyde dehydrogenases from Comamonas testosteroni SC1588 through gene mining technology, and its amino acid sequences are SEQ ID.1, SEQ ID.2, SEQ ID.3, and SEQ ID .4 or shown in SEQ ID.5. The five aldehyde dehydrogenases of the present invention can efficiently catalyze the selective oxidation of bio-based furan to synthesize the corresponding furan carboxylic acid, the yield of the target product is as high as about 90%, and the highest yield can even reach 100%; the space-time yield reaches 1.9g / L h. The invention has simple production process, mild production conditions and high production efficiency.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and biocatalysis, and specifically relates to five kinds of aldehyde dehydrogenases derived from Comamonas testosteroni SC1588, coding genes, recombinant bacteria expressing aldehyde dehydrogenases and their catalytic biological bases. Application of selective oxidation of furan to furan carboxylic acid. Background technique [0002] Furancarboxylic acids such as 5-hydroxymethyl-2-furancarboxylic acid (5-hydroxymethyl-2-furancarboxylic acid, HMFCA), 2-furancarboxylic acid (2-furancarboxylic acid, FCA) and 2,5-furandicarboxylic acid (2,5-furandicarboxylic acid, FDCA) is an important class of bio-based chemicals, which have important application value in the fields of polymers and medicine. For example, HMFCA is a key raw material for the synthesis of various bio-based polyesters (Makromol. Chem., 1984, 185, 2347) and bio-based terephthalic acid (ACS Catal., 2016, 6, 5052). Polyethyle...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/70C12N1/21C12P17/04C12R1/19
CPCC12N9/0008C12N15/70C12P17/04C12Y102/01067C12Y102/01068C12Y102/01083
Inventor李宁张雪莹宗敏华
OwnerSOUTH CHINA UNIV OF TECH