Preparation method of FISH probe of TOP2A gene

A probe and gene technology, applied in the field of FISH probe preparation, can solve problems such as affecting the accuracy of detection, increasing false positive and false negative signals, and reducing detection sensitivity.

Active Publication Date: 2019-04-12
SUREXAM BIO TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The above-mentioned technical idea is the conventional method of FISH detection method. After an in-depth analysis of its specific operation details, it can be found that: (1) the probe is involved in the target DNA region of the sample to be tested. Usually, one probe DNA molecule binds to one target For DNA molecules, once a single probe off-target occurs, it will have a significant impact on the detection signal; (2) The impact of a single probe off-target on the detection signal will then indirectly affect the accuracy of the detection, and the possibility of false positive and false negative signals will increase; (3) In addition to the impact on the detection signal and accuracy, the off-target of a single probe will also significantly reduce the sensitivity of detection; (4) In addition, the length of the probe molecule involved in TOP2A is about 300bp, as known in the art, The larger the probe molecule, the less likely it is to enter the interior of the cell
[0009] It can be seen that although the existing TOP2A gene detection technology has achieved relatively good results in some aspects, there are still many technical problems due to limitations in its design principles and other aspects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of FISH probe of TOP2A gene
  • Preparation method of FISH probe of TOP2A gene
  • Preparation method of FISH probe of TOP2A gene

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0115] A method for preparing a FISH probe library of TOP2A gene includes the following steps:

[0116] (1) Prepare probe 1A and probe 1B;

[0117] (2) After cutting and interrupting probe 1A and probe 1B obtained in step (1) respectively, using Taq DNA polymerase for end-filling and 3'-end dA tailing to obtain probes 2A and 2B, respectively;

[0118] The interrupted system of enzyme digestion is:

[0119] Reagent

Add amount

10×CutSmart Buffer

5μL

Restriction Enzyme Mix

2μL

Probe 1A or 1B (1ng / μL)

40μL

Taq DNA polymerase (5U / μL)

0.5μL

10mM dNTP

1μL

ddH 2 O

1.5μL

[0120] The reaction conditions for digestion interruption are: digestion at 37°C for 30 minutes, reaction at 72°C for 20 minutes, and reaction at 80°C for 20 minutes;

[0121] (3) Add linkers to probes 2A and 2B obtained in step (2) to obtain probes 3A and 3B, respectively;

[0122] The ligation reaction system is:

[0123] Reagent

Add amount

10×T4 DNA ligase buffer

10μL

T4DNA Ligase (400U / μL)

4μ...

Embodiment 7

[0128] The conditions of the ligation reaction in Example 7 were:

[0129] temperature

time

16℃

60min

65℃

10min

4℃

[0130] The ligation product was purified with a purification kit HiPure Nucleotide Remove Kit. The product was eluted with 25μl sterile ultrapure water, and 20μl was used in the subsequent steps.

[0131] (4) Asymmetrically amplify probes 3A and 3B obtained in step (3) to obtain a FISH probe library;

[0132] Asymmetric amplification reaction system:

[0133] Reagent

Add amount

5X EpiMark Hot Start Taq Reaction Buffer

10μL

dNTP mixture (containing aminoallyl-dUTP)

3μL

Epimark Hot stratTaq DNApolymerase

0.25μL

Nuclease-free water

14.75μL

Primer F (1μM)

1μL

Primer R (20μM)

1μL

Probe 3A or 3B

20μL

[0134] Primer F and primer R are:

[0135] name

Base sequence (5’→3’)

Primer F

CCTCTGTATGCGCATCCTGTGAT

Primer R

TCGGAGACACTCAGAGATGTGATGG

[0136] In Examples 1-7 and 9, the dNTP mixture (containing aminoallyl-dUTP) is:

[0137] d...

Embodiment 1-9

[0147] Embodiments 1-9 are based on the basic embodiments and adjusted various parameters to obtain the following embodiments:

[0148]

[0149]

[0150]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of biochemistry and particularly belongs to the field of biochemical related measurement or detection, and more specifically relates to a preparation methodof a FISH probe of a TOP2A gene, and the probe prepared by the method. The provided method prepares a probe library by using BAC cloning, enzyme digestion, asymmetric amplification, etc., so that theproduct is effectively improved in sensitivity, specificity and signal intensity.

Description

Technical field [0001] The invention belongs to the field of biochemistry, in particular to the field of biochemistry-related measurement or detection; more specifically, it relates to a method for preparing a FISH probe for TOP2A gene and a probe prepared by the method. Background technique [0002] DNA topoisomerase (Topoismoerase, TOP) is an important ribozyme in the cell, which changes the topological structure of DNA mainly through catalysis. The topoisomerases of eukaryotic cells are mainly divided into TOP1 and TOP2. Among them, the intermediate product formed during the catalysis process causes a short break in DNA double-strand is called TOP2. TOP2 plays an important role in important life processes such as cell DNA replication, transcription and mitosis. Based on the understanding of the key role of TOP in cells, the research on these substances has always been one of the hot spots in the research and development of anti-tumor drugs. Currently listed topoisomerase II...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6841C12Q1/6806C12N15/10C40B50/06
CPCC12N15/1093C12Q1/6806C12Q1/6841C12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/156C40B50/06C12Q2563/107C12Q2525/191C12Q2531/107C12Q2521/301
Inventor许嘉森吴诗扬刘志明朱蓉
OwnerSUREXAM BIO TECH