Dehalogenase gene LinB, dehalogenase, dehalogenase genetically engineered bacteria and construction method and application method of dehalogenase genetically engineered bacteria

A technology of genetic engineering bacteria and dehalogenase, applied in the field of dehalogenase genetic engineering bacteria and its construction, dehalogenase gene LinB, and dehalogenase, and can solve the problem of high cost, complicated process, and limited chemical degradation method popularization and application, etc. problem, to achieve the effect of stable system and simple production process

Inactive Publication Date: 2019-05-03
UNIT 92609 OF PLA
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, chemical degradation methods represented by photocatalytic technology have achieved certain results, but the process is complex and expensive, which limits the popularization and application of chemical degradation methods represented by photocatalytic technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dehalogenase gene LinB, dehalogenase, dehalogenase genetically engineered bacteria and construction method and application method of dehalogenase genetically engineered bacteria
  • Dehalogenase gene LinB, dehalogenase, dehalogenase genetically engineered bacteria and construction method and application method of dehalogenase genetically engineered bacteria
  • Dehalogenase gene LinB, dehalogenase, dehalogenase genetically engineered bacteria and construction method and application method of dehalogenase genetically engineered bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Construction and Verification of Dehalogenase Genetic Engineering Bacteria

[0051] 1), the acquisition of dehalogenase synthesis gene

[0052]The construction method and application of dehalogenase genetically engineered bacteria, through codon optimization, NdeI site should be introduced upstream, and Xho I site should be introduced downstream, so as to be connected with pET-28a(+) vector in the next step. Using the synthetic dehalogenase gene as a template, PCR amplification was carried out under the action of primer 1 (CATATGTCTCTGGGTGCTAA, shown in SEQ ID NO.3 in the sequence table) and primer 2 (CTCGAGTTAAGCCGGACGCA, shown in SEQ ID NO.4 in the sequence table). increase.

[0053] The amount of each component in the PCR reaction system (total volume 50 μL): 5 μL of 10XPfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of each cloning primer 1 and primer 2 at a concentration of 50 μM, and no nucleic acid Make up...

Embodiment 2

[0062] Drawing of 2-CEES / dichloromethane standard curve

[0063] 1) Add 1mg, 2mg, 3mg, 4mg, 5mg of 2-CEES respectively into 10mL test tubes (dropping with a micro-syringe, the actual mass is subject to the balance reading).

[0064] 2) Stir the 5 test tubes separately and take about 1mL of the sample in step 1) for gas chromatography GC analysis to obtain a standard curve of peak area and concentration, R2≥99.99%

[0065] 3), the gas chromatograph is Shimadzu GC-2010, and the gas chromatograph conditions are as follows:

[0066] a) Chromatographic column: HP-5 column;

[0067] b) The injection port is at 250°C, which is convenient for gasification;

[0068] c) detector FID or FPD;

[0069] d) The programmed temperature is set at 50°C for 2 minutes, then raised to 200°C at 15°C / min, and held for 1 minute.

[0070] 4) Determination of the removal rate of engineering bacteria 2-CEES: Take 5 parallel 5mL culture supernatants, add an equivalent amount of 5mg 2-CEES respectively...

Embodiment 3

[0074] Remediation of 2-CEES Contaminated Soil by Dehalogenase Genetic Engineering Bacteria

[0075] The broken bacterial suspension of the dehalogenase genetically engineered bacteria obtained in Example 1 can be directly sprayed on soil contaminated with chlorinated hydrocarbons such as HCH to realize in-situ restoration of contaminated soil, and the contaminated soil can also be mixed with the dehalogenase The suspension of genetically engineered bacteria is mixed, and the growth and reproduction of dehalogenase genetically engineered bacteria is realized by adding LB medium regularly, so as to achieve the purpose of gradual restoration of contaminated soil.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a dehalogenase gene LinB, dehalogenase, dehalogenase genetically engineered bacteria and a construction method and application method of the dehalogenase genetically engineeredbacteria. The dehalogenase gene LinB comprises (a) a nucleotide sequence as shown in SEQ ID NO.1, (b) a nucleotide sequence for coding an amino acid sequence as shown in SEQID NO.2, or (c), a variantof (a) or(b). The dehalogenase comprises polypeptide coded by a nucleotide sequence as shown in SEQID NO.1, an amino acid sequence as shown in SEQ ID NO.2, or a variant of the amino acid sequence. Theconstruction method of the dehalogenase genetically engineered bacteria comprises the steps of cloning the dehalogenase gene LinB into a recombinant expression carrier, and performing guiding into host cells so as to obtain the dehalogenase genetically engineered bacteria capable of expressing the dehalogenase.

Description

technical field [0001] The invention relates to the technical field of microorganisms, in particular to a dehalogenase gene LinB, a dehalogenase, a dehalogenase genetically engineered bacterium, a construction method and an application method thereof. Background technique [0002] Organochlorine pollutants, represented by the herbicide HCH and mustard gas, are a class of persistent organic pollutants, which have the characteristics of stable structure and long-lasting effect. In the last century, the insecticide 666 was widely used because of its good insecticidal effect, but it caused irreparable harm to the environment. In addition, due to the high fat solubility of 666, the impact on human beings through the accumulation of food chains is gradually appearing and increasing day by day. [0003] In addition, during World War II, the Japanese invaders abandoned hundreds of tons of chemical agents and millions of rounds of chemical ammunition in our country, most of which we...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/63A62D3/02A62D101/22
Inventor乔江波李健陈高云葛春园张也王钰
OwnerUNIT 92609 OF PLA