A method for obtaining a new poplar variety with high resistance to willow blue leaf methoplast transgenic bt gene
A new variety and gene technology, applied in the field of obtaining new varieties of poplars with high resistance to Bt-transgenic poplar, can solve the problems of gene escape, uncertainty of gene integration sites, and difficulty in overcoming, and achieve biological safety Good results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] The construction of the plastid transformation vector of populus transgenic Bt-cry3Bb gene:
[0062] Using the p3300-cry3Bb plasmid DNA as a template, use the pair of primers cry3Bb-F (5'GCGGCCGCTCAGAGCTGGACAGGGATGAACTC 3'SEQ ID NO: 2) and cry3Bb-R (5'CCATGGCCAACCCTAACAACAGGTC 3'SEQ ID NO: 3), and then use Pfu enzyme to pass The cry3Bb gene sequence was amplified by PCR, and the PCR product was purified by a PCR clean kit, and combined with a blunt-ended vector -Blunt Simple was connected and transformed into Escherichia coli XL10-gold, and the obtained recombinant was verified by PCR and enzyme digestion, and then sent to a sequencing company for sequencing verification. The verified correct recombinant was named pYY24. Digest the plasmid pYY24DNA with restriction endonucleases Nco I and Not I, and after agarose gel electrophoresis, cut out the small fragments on the corresponding gel, recover them with a gel recovery kit, and extract the obtained small fragments Liga...
Embodiment 2
[0064] Using gene gun method to introduce pYY26 plasmid DNA into the genome of Populus japonicus and screening of resistant buds:
[0065] The pYY26 plasmid DNA was wrapped with 0.6 μm gold powder, and the poplar leaves were bombarded with a Bio-Rad gene gun (PDS-1000 / He). 9cm), vacuum degree 28. The specific operation was carried out according to the gene gun operation manual, and was carried out with reference to the poplar plastid gene gun transformation method. The leaf material bombarded by the gene gun was cut into a size of 3*3mm, placed on the PaSIM1 selection medium containing 30mg / L spectinomycin with the abaxial side up until resistant buds appeared, on this medium every 1- The culture medium was changed once every February. The screening culture conditions are: 25°C 16h light / 20°C 8h dark, light intensity: 20-25μE·m -2 ·s -1 .
Embodiment 3
[0067] Obtaining and Molecular Identification of Populus montana Transgenic Bt-cry3Bb Gene Plants:
[0068] Preliminary identification of the resistant buds of Populus japonicus transfected with Bt-cry3Bb gene: the leaves of the resistant buds grown on 30mg / L spectinomycin PaSIM2 and the leaves of wild-type poplar japonicus grown conventionally were extracted to extract the total DNA of the leaves as The template was tested by PCR with primers JC-Pa-F (5'GGGTATATCTCTTCTTAAAGTTAAACTGCAGTATTTG3'SEQ ID NO: 4) and JC-Pa-R (5'CGGTACTTGTGATATTTCGGCTTG 3'SEQ ID NO: 5), and it was found that: The control and the wild-type control did not amplify a band similar to the size of the gene (1972bp), while the transgenic Bt-cry3Bb gene Sanxin Yang Pa-YY26#1 strain and Pa-YY26#2 strain amplified to a band similar to the gene size (1972bp). The similar bands of the gene size (1972bp) indicate that the gene has been transferred into the cells of Populus pubescens; the negative control and the w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More