Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for establishing HK2 report gene cell line of colon cancer

A reporter gene and cell line technology, applied in the field of colorectal cancer HK2 reporter gene cell line and its establishment, can solve the problem of not establishing a colorectal cancer HK2 reporter gene, and achieve the promotion of drug metabolism evaluation and related gene function research and knock-in The efficiency is improved, the method is simple and easy to implement, and the effect

Active Publication Date: 2019-06-07
GUANGDONG MEDICAL UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, there is currently no rapid and efficient method for establishing a stable cell line of the colorectal cancer HK2 reporter gene. This study focuses on the field of the colorectal cancer HK2 reporter gene, using CRISPR-Cas9 technology to construct a cell line with enhanced green fluorescent protein (EGFP ) cell line of the colorectal cancer HK2 reporter gene, which provides a favorable tool for the study of the HK2 gene and its signaling pathway, the study of the pathogenic mechanism of related diseases, drug screening and evaluation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing HK2 report gene cell line of colon cancer
  • Method for establishing HK2 report gene cell line of colon cancer
  • Method for establishing HK2 report gene cell line of colon cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Establishment of colorectal cancer HK2 reporter gene cell line

[0044] Step 1: Design and evaluate suitable HK2-sgRNA sequences:

[0045] Through screening and evaluation, two sgRNA sequences were obtained, which are:

[0046] HK2-sgRNA1: TAGAACCCCTGAAATCGGAA (chr2:74890939-74890958), as shown in SEQ ID NO.1.

[0047] HK2-sgRNA2: TGTGTCAGAGACAGACCCCT (chr2: 74891015-74891034), as shown in SEQ ID NO.2.

[0048] Step 2: Construct pX459-sgRNA plasmid, including the following steps:

[0049] According to the sequence of HK2-sgRNA1 or HK2-sgRNA2, the plasmid pX459 / HK2-sgRNA1 or pX459 / HK2-sgRNA2 with the correct sgRNA sequence can be directly obtained after synthesis by the biological company.

[0050] Step 3: Integrate the L-EGFP-R fragment, including the following steps:

[0051] According to the homology arm of the HK2 gene and the EGFP sequence, the correct integrated fragment L-EGFP-R was directly obtained after being synthesized by the biological company....

Embodiment 2

[0064] Example 2 Functional verification of colorectal cancer HK2 reporter gene cell line

[0065] Design 3 different small interfering RNAs specifically targeting the HK2 gene, such as Figure 6 The shown shRAN-1, shRAN-2, and shRAN-3 were respectively transfected into the HK2 reporter cell line. After 72 hours, the analysis of the transcription level showed that compared with the non-knockdown control, the three specific small interfering RNAs effectively reduced the expression level of the HK2 gene (approximately 70-80% knockdown); at the same time, EGFP gene expression is also correspondingly reduced by 70-80% along with HK2 gene knockdown. The experimental results prove from the molecular level that the reporter gene EGFP and the HK2 gene in the colorectal cancer HK2 reporter gene cell line constructed by the present invention can be synchronously co-expressed, and can be synchronously inhibited by shRNA, which can be used for tracking the suppression or overexpression of...

Embodiment 3

[0066] Example 3 drug screening and evaluation verification

[0067] 2-Methoxyestradiol (2-MeOE2) is a HIF inhibitor, which has entered the phase II anti-tumor clinical trial. Using this inhibitor to treat the HK2 cell line, it was found that the expression of EGFP and HK2 were jointly inhibited, see Figure 7 . After the HK2 cell line was treated with 2-MeOE2 (10uM) for 24h and 48h, the relative expression changes of HK2 and EGFP transcript levels compared with the untreated control were analyzed. The results showed that the expression level of HK2 was significantly inhibited, and the expression of EGFP was also synergistically inhibited; The experimental results further prove that the HK2 reporter gene cell line of colorectal cancer constructed by the present invention can be used to screen and evaluate related anticancer drugs.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for establishing an HK2 report gene cell line of the colon cancer. The method comprises the specific steps of firstly designing a specificity sgRNA sequence of a HK2 gene site, and performing cloning into a plasmid PX459; integrating a homologous recombination sequence of an HK2 gene and a green fluorescent protein DNA fragment (EGFP), and performing joint electricshock on the plasmid and the integrated fragment to transform a colon cancer cell line HCT116; performing unicellular screening on EGFP expression cells through a flow cytometer, and amplifying a monoclonal cell line; and performing PCR identification and immunoblotting verification on the screened EGFP expression cell line so as to obtain a positive HK2 report gene cell line. The colon cancer cell line cell line HK2 gene and EGFP are in co-expression, and the EGFP expression level and the HK2 gene have high consistency, so that through detecting EGFP expression level changes, the HK2 gene expression level can be accurately judged. The method for establishing the cell line is simple, and easy to operate, and gene sites can be efficiently and accurately positioned.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a colorectal cancer HK2 reporter gene cell line and its establishment method. Background technique [0002] The energy required for cell survival mainly comes from glycolysis in the cytoplasm and aerobic oxidation in the mitochondria. In the 1920s, German biologist Otto Warburg discovered that tumor cells would use glucose for glycolysis and produce lactic acid under aerobic conditions. A new way of thinking. The research results of Gillies RJ et al. show that in normal tissues, 10% of the total ATP synthesized by cells is provided by the glycolytic pathway, and mitochondria provide the remaining 90% of the energy, while in tumor cells the energy provided by the glycolytic pathway accounts for 50% -70%, the additional energy comes from mitochondria (Cancer and Metastasis Reviews, 2007.26(2):311-317.2). Existing studies have proved that hexokinase is the first rate-limiting key enz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/90C12Q1/02C12R1/91
CPCC12N2503/02C12N2510/00C12N5/0693C12N15/907C12N2310/20C12Q1/6897
Inventor 余红兵刘欣
Owner GUANGDONG MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products