Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific dna fragments for sex identification of silktail fish and their application

A silk-tailed, specific technology, which is applied in the field of fish sex identification, can solve the problems of limited genetic information resources, inability to detect sex-specific DNA molecular markers, etc., and achieve the effect of less damage to the fish body.

Active Publication Date: 2020-02-04
INST OF AQUATIC LIFE ACAD SINICA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

DNA molecular markers have become an important molecular tool for fish sex identification, although using traditional molecular marker development techniques such as AFLP, microsatellites and RAPD, sex-specific molecular markers have been successfully developed in some fish (Bello & Sánchez, 1999; Shan et al,2015; Pan et al,2015), but due to their limited genetic information resources, sex-specific DNA molecular markers cannot be detected in many fishes (Gao et al,2010; Sriphairoj et al,2007; Yarmohammadi et al ,2011)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific dna fragments for sex identification of silktail fish and their application
  • Specific dna fragments for sex identification of silktail fish and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Acquisition of specific DNA tag fragments MWMSM1 and MWMSM2 for sex identification of silktail fish:

[0026] During the breeding season, 10 males and 10 females were identified by artificial egg extraction and dissection to observe the gonads. The tail fins were cut off and the whole genome DNA was extracted, and the target genome was digested with two enzymes, BsaXI and SapI. , construct a sequencing library, perform 2b-RAD sequencing on the Illumina sequencing platform, and select one of the male fish for whole-genome survey sequencing to obtain a reference sequence. Through comparative genomics analysis of the tag sequences of male and female individuals, sex-specific DNA fragment tag sequences were obtained, and corresponding primers were designed at both ends of the tag sequence according to the position of the tag sequence in the genome survey for population validity verification, and finally the male Specific DNA tag sequences MWMSM1 (shown in SEQ ID NO.1), MWMS...

Embodiment 2

[0028] How to use silktail male-specific DNA tags MWMSM1 and MWMSM2:

[0029] 1) The primers designed for the sequences shown in the male-tailed cypress male-specific DNA tag sequences SEQ ID NO.1 and SEQ ID NO.2 are:

[0030] MWMSM1, F: GCTGTGTATTTACTTACCGTTAACGGG and R: TGCTGCCGGGGACCATTCCCGA.

[0031] MWMSM2, F: CACACAGACACAAGCTAATCCTACATTCAC and R: GGTTGCGTGTTGAAATCCCCAGCTC.

[0032] 2) PCR amplification:

[0033] The reaction system is about 50ng of template DNA; 2×Es Taq MasterMix Polymerase 12.5 μl; ddH 2 O was 9.5 μl; the upstream and downstream primers were diluted to 10 μM and 1 μl was added; the template was added 1 μl, and the final system was 25 μl.

[0034] The PCR reaction conditions for all primers were pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 25 s, and 35 cycles; final extension at 72°C for 10 min; storage at 4°C.

[0035] After the PCR amplification is completed, a 2% agarose ge...

Embodiment 3

[0037] Application of male-specific DNA markers MWMSM1 and / or MWMSM2 in sex determination of silktail seabream populations:

[0038] 1) Collect 9 male and female silktails with known sex, collect fin ray tissue samples and store them in absolute ethanol, use a DNA extraction kit to extract their genomic DNA, dilute to 50ng / μL and store at -20°C for later use; The collected samples included wild samples.

[0039] 2) Utilize the method for embodiment 2 to carry out PCR amplification to above-mentioned silktail cichlid DNA sample;

[0040] 3) The amplification result is as follows:

[0041]figure 1 It is a schematic diagram of the results of genetic sex identification of the silktail male sex-specific DNA fragment MWMSM1 in the silktail population. Individual numbers 1-9 in the figure are female individuals that cannot amplify bands, individual numbers 10-18 are male individuals that can amplify 146bp specific bands, and M indicates DL2000 DNA marker.

[0042] figure 2 It is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of fish sex identification in the field of aquaculture, and particularly relates to a specific DNA fragment for hemibagrus wyckioides sex determination and application. On the basis of combining a low coverage whole genome survey technology with a 2b-RAD-seq technology, and by means of a genome walking technology, hemibagrus wyckioides male sex specific markerisdeveloped, the specific DNA fragment is shown in SEQIDNO.2 or SEQIDNO.1. For the specific sequence, the sex of hemibagrus wyckioides can be identified by means of conventional PCR amplification, and it is verified thatthe accuracy rate reaches 100%. Compared with previous anatomical detection or genital swelling observation, thetechnology is accurate, simple, rapid, less in harmful to fish body and the like, and help is provided for hemibagrus wyckioides sex control breeding, wild resource protection and the development of the aquaculture industry.

Description

technical field [0001] The invention belongs to the field of fish sex identification in the field of aquaculture, and in particular relates to a specific DNA fragment for sex identification of silktail fish and its application. Background technique [0002] Hemibagrus wyckioides is a sub-wide-haline bottom-dwelling fish that is only distributed in the Lancang River system and the Mekong River Basin in the lower reaches of my country. Silk-tailed porcupine has strong adaptability, easy reproduction, strong disease resistance, delicious meat, and high nutritional value. It is a famous and high-quality new breed that is worth developing and promoting. It is one of the most valuable wild fish in Yunnan. However, due to overfishing and the construction of hydropower stations on the main and tributary streams of the Lancang River, wild resources are becoming less and less, so wild resources need to be protected. At the same time, like many commercial fish species, there is a sign...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6879C12Q1/6888C12N15/11
Inventor 王忠卫周于琳桂建芳周莉
Owner INST OF AQUATIC LIFE ACAD SINICA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More