Specific dna fragments for sex identification of silktail fish and their application
A silk-tailed, specific technology, which is applied in the field of fish sex identification, can solve the problems of limited genetic information resources, inability to detect sex-specific DNA molecular markers, etc., and achieve the effect of less damage to the fish body.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Acquisition of specific DNA tag fragments MWMSM1 and MWMSM2 for sex identification of silktail fish:
[0026] During the breeding season, 10 males and 10 females were identified by artificial egg extraction and dissection to observe the gonads. The tail fins were cut off and the whole genome DNA was extracted, and the target genome was digested with two enzymes, BsaXI and SapI. , construct a sequencing library, perform 2b-RAD sequencing on the Illumina sequencing platform, and select one of the male fish for whole-genome survey sequencing to obtain a reference sequence. Through comparative genomics analysis of the tag sequences of male and female individuals, sex-specific DNA fragment tag sequences were obtained, and corresponding primers were designed at both ends of the tag sequence according to the position of the tag sequence in the genome survey for population validity verification, and finally the male Specific DNA tag sequences MWMSM1 (shown in SEQ ID NO.1), MWMS...
Embodiment 2
[0028] How to use silktail male-specific DNA tags MWMSM1 and MWMSM2:
[0029] 1) The primers designed for the sequences shown in the male-tailed cypress male-specific DNA tag sequences SEQ ID NO.1 and SEQ ID NO.2 are:
[0030] MWMSM1, F: GCTGTGTATTTACTTACCGTTAACGGG and R: TGCTGCCGGGGACCATTCCCGA.
[0031] MWMSM2, F: CACACAGACACAAGCTAATCCTACATTCAC and R: GGTTGCGTGTTGAAATCCCCAGCTC.
[0032] 2) PCR amplification:
[0033] The reaction system is about 50ng of template DNA; 2×Es Taq MasterMix Polymerase 12.5 μl; ddH 2 O was 9.5 μl; the upstream and downstream primers were diluted to 10 μM and 1 μl was added; the template was added 1 μl, and the final system was 25 μl.
[0034] The PCR reaction conditions for all primers were pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 25 s, and 35 cycles; final extension at 72°C for 10 min; storage at 4°C.
[0035] After the PCR amplification is completed, a 2% agarose ge...
Embodiment 3
[0037] Application of male-specific DNA markers MWMSM1 and / or MWMSM2 in sex determination of silktail seabream populations:
[0038] 1) Collect 9 male and female silktails with known sex, collect fin ray tissue samples and store them in absolute ethanol, use a DNA extraction kit to extract their genomic DNA, dilute to 50ng / μL and store at -20°C for later use; The collected samples included wild samples.
[0039] 2) Utilize the method for embodiment 2 to carry out PCR amplification to above-mentioned silktail cichlid DNA sample;
[0040] 3) The amplification result is as follows:
[0041]figure 1 It is a schematic diagram of the results of genetic sex identification of the silktail male sex-specific DNA fragment MWMSM1 in the silktail population. Individual numbers 1-9 in the figure are female individuals that cannot amplify bands, individual numbers 10-18 are male individuals that can amplify 146bp specific bands, and M indicates DL2000 DNA marker.
[0042] figure 2 It is...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

