Ammonolysis method and ammonolysis composition

A composition and a technology for ammonolysis, applied in the field of ammonolysis, can solve the problems of long time-consuming, high equipment requirements, long time-consuming, etc. to drain the mixed solution of water and methanol. The effect of pollution

Active Publication Date: 2019-07-02
GENSCRIPT NANJING
View PDF7 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method has the following disadvantages: 1) the ammonolysis reagent is easy to volatilize in the process and causes poor repeatability; 2) repeated cooling, the operation is too complicated, and the overall time-consuming is long; 3) the primers cannot be cleaned after the reaction ends, and It takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ammonolysis method and ammonolysis composition
  • Ammonolysis method and ammonolysis composition
  • Ammonolysis method and ammonolysis composition

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0065] Example 1

[0066] The purpose of this embodiment is to synthesize primers with lengths of 25, 60 and 100 bases. The sequences are as follows:

[0067] 5’-AAACCCAGGGCCTCAAGGACAAACC-3’ (target molecular weight is 7623.0)

[0068] 5’-

[0069] TTCTTTCCTCCCTAAACACTGACCTCCCGCAGTCTTCACTAGCAGGTGAGGTCACCTGTA-3’ (target molecular weight is 18232.8)

[0070] 5’-

[0071] GTACCGAGCTCGGATCCGCCACCATGGCTGAAAATAGTGTATTAACATCCACTACTGGGAGGACTAGCTTGGCAGACTCTTCCATTTTTGATTCTAAAGT-3’ (target molecular weight is 30782.0)

[0072] 1. Primer synthesis

[0073] Use 50nmol synthesis column (purchased from Beijing Dina Xingke Biotechnology Co., Ltd., C1001-50), tetrazolium as the activation reagent, 3% (v / v) trichloroacetic acid / dichloromethane as the deprotection reagent, 20% (v / v) Acetic anhydride / acetonitrile, 16% (v / v) nitromethylimidazole / acetonitrile are capping reagents, and 0.025M iodine solution is oxidizing reagent. Synthesize the corresponding primer sequences on the Dr. Oligo 192 synthesizer.

...

Example Embodiment

[0085] Example 2

[0086] The purpose of this example is to synthesize primers of 25, 60 and 100 bases in length, using traditional microwave aminolysis, and compare the results with the microwave aminolysis composition provided by the present invention. The synthesized sequences are:

[0087] 5’-AAACCCAGGGCCTCAAGGACAAACC-3’ (target molecular weight is 7623.0)

[0088] 5’-

[0089] TTCTTTCCTCCCTAAACACTGACCTCCCGCAGTCTTCACTAGCAGGTGAGGTCACCTGTA-3’ (target molecular weight is 18232.8)

[0090] 5’-

[0091] GTACCGAGCTCGGATCCGCCACCATGGCTGAAAATAGTGTATTAACATCCACTACTGGGAGGACTAGCTTGGCAGACTCTTCCATTTTTGATTCTAAAGT-3’ (target molecular weight is 30782.0)

[0092] 1. Primer synthesis

[0093] Using a 50nmol synthesis column, tetrazolium is the activation reagent, 3% (v / v) trichloroacetic acid / dichloromethane is the deprotection reagent, 20% (v / v) acetic anhydride / acetonitrile, 16% (v / v) ) Nitromethimidazole / acetonitrile is a capping reagent, and 0.025M iodine solution is an oxidizing reagent. Synthesi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The application of the invention provides a method for performing ammonolysis after DNA solid phase synthesis. The method comprises the following steps of (1) adding an ammonolysis composition to a synthesizing column including a solid phase carrier for synthesizing DNA fragments; (2) placing the synthesizing column in a sealable container loaded with ammonolysis buffer solutions, and maintainingthe synthesizing column to be above the liquid surface of the ammonolysis buffer solutions; (3) performing microwave treatment on the sealable container so that the solid phase carrier is in the steamatmosphere of the ammonolysis buffer solution; and (4) taking out the synthesizing column, treating the solid phase carrier with an eluent, and collecting effluent. The invention further provides anammonolysis composition for ammonolysis. According to the ammonolysis method provided by the invention, only a small quantity of ammonolysis reagents are used, cross infection can be avoided, reactiontime can be shortened, cleaning with cleaning solvents is convenient, high-voltage equipment is not needed, and industrialization and automation use are facilitated.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to an ammonolysis method related to DNA solid-phase synthesis. The invention also relates to an ammonolysis composition for use in ammonolysis. Background technique [0002] DNA synthesis (especially DNA primer synthesis) is mostly based on solid-phase synthesis technology, through the cycle of four steps of deprotection, condensation, oxidation and capping, the phosphoramidite monomers are connected one by one in the order from 3' end to 5' end onto the surface of a controlled pore glass sphere (CPG). The 5' terminal hydroxyl of each phosphoramidite monomer is protected by a dimethoxytriphenyl (DMT) group, and the active amino groups on the base are respectively composed of acetyl (Ac), benzoyl (Bz), di Nitrogen methyl formamido group (dmf) and other groups to protect. Among them, the DMT group is acid-labile and can be removed in a solution such as 3% trichloroacetic acid in dichl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07H21/00
CPCC07H21/00
Inventor 王建鹏贺玉卓范玉峰赵禹
Owner GENSCRIPT NANJING
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap